ID: 1073076225

View in Genome Browser
Species Human (GRCh38)
Location 10:100827159-100827181
Sequence ACTCCCGGCGACCCGACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073076214_1073076225 28 Left 1073076214 10:100827108-100827130 CCTGGCTGGCCGGCGGCTCAGCG 0: 1
1: 0
2: 1
3: 26
4: 214
Right 1073076225 10:100827159-100827181 ACTCCCGGCGACCCGACCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 50
1073076221_1073076225 2 Left 1073076221 10:100827134-100827156 CCGCGCGGCTTCTGGGCACGGTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1073076225 10:100827159-100827181 ACTCCCGGCGACCCGACCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 50
1073076216_1073076225 19 Left 1073076216 10:100827117-100827139 CCGGCGGCTCAGCGCGGCCGCGC 0: 1
1: 0
2: 1
3: 20
4: 219
Right 1073076225 10:100827159-100827181 ACTCCCGGCGACCCGACCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073076225 Original CRISPR ACTCCCGGCGACCCGACCTC TGG Intronic