ID: 1073079656

View in Genome Browser
Species Human (GRCh38)
Location 10:100851065-100851087
Sequence TCCACCTGACCCTCAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073079653_1073079656 26 Left 1073079653 10:100851016-100851038 CCATCCTCTCTGCTGGTGATTCT No data
Right 1073079656 10:100851065-100851087 TCCACCTGACCCTCAAATGCTGG No data
1073079654_1073079656 22 Left 1073079654 10:100851020-100851042 CCTCTCTGCTGGTGATTCTCTGT No data
Right 1073079656 10:100851065-100851087 TCCACCTGACCCTCAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073079656 Original CRISPR TCCACCTGACCCTCAAATGC TGG Intergenic
No off target data available for this crispr