ID: 1073080769

View in Genome Browser
Species Human (GRCh38)
Location 10:100859297-100859319
Sequence AGAGCCTAAAAGGGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073080769_1073080776 13 Left 1073080769 10:100859297-100859319 CCTTCTTCACCCTTTTAGGCTCT No data
Right 1073080776 10:100859333-100859355 CCTCTCCTCTCCTCTCCTTCTGG No data
1073080769_1073080781 24 Left 1073080769 10:100859297-100859319 CCTTCTTCACCCTTTTAGGCTCT No data
Right 1073080781 10:100859344-100859366 CTCTCCTTCTGGGGAGAAGCTGG No data
1073080769_1073080777 14 Left 1073080769 10:100859297-100859319 CCTTCTTCACCCTTTTAGGCTCT No data
Right 1073080777 10:100859334-100859356 CTCTCCTCTCCTCTCCTTCTGGG No data
1073080769_1073080778 15 Left 1073080769 10:100859297-100859319 CCTTCTTCACCCTTTTAGGCTCT No data
Right 1073080778 10:100859335-100859357 TCTCCTCTCCTCTCCTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073080769 Original CRISPR AGAGCCTAAAAGGGTGAAGA AGG (reversed) Intergenic
No off target data available for this crispr