ID: 1073081304

View in Genome Browser
Species Human (GRCh38)
Location 10:100862679-100862701
Sequence ACACTGTGCCAGCCAAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073081304_1073081309 21 Left 1073081304 10:100862679-100862701 CCTGATCTTGGCTGGCACAGTGT No data
Right 1073081309 10:100862723-100862745 ATGATTGTTGAACAAGTGAATGG No data
1073081304_1073081310 29 Left 1073081304 10:100862679-100862701 CCTGATCTTGGCTGGCACAGTGT No data
Right 1073081310 10:100862731-100862753 TGAACAAGTGAATGGCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073081304 Original CRISPR ACACTGTGCCAGCCAAGATC AGG (reversed) Intergenic
No off target data available for this crispr