ID: 1073083035

View in Genome Browser
Species Human (GRCh38)
Location 10:100871772-100871794
Sequence CTGGAGGTTCCTGCATTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073083026_1073083035 1 Left 1073083026 10:100871748-100871770 CCCCAGGACAGGCCATGCATAGT No data
Right 1073083035 10:100871772-100871794 CTGGAGGTTCCTGCATTGGAGGG No data
1073083028_1073083035 -1 Left 1073083028 10:100871750-100871772 CCAGGACAGGCCATGCATAGTCC No data
Right 1073083035 10:100871772-100871794 CTGGAGGTTCCTGCATTGGAGGG No data
1073083023_1073083035 14 Left 1073083023 10:100871735-100871757 CCTAACTAGGGTCCCCCAGGACA No data
Right 1073083035 10:100871772-100871794 CTGGAGGTTCCTGCATTGGAGGG No data
1073083025_1073083035 2 Left 1073083025 10:100871747-100871769 CCCCCAGGACAGGCCATGCATAG No data
Right 1073083035 10:100871772-100871794 CTGGAGGTTCCTGCATTGGAGGG No data
1073083027_1073083035 0 Left 1073083027 10:100871749-100871771 CCCAGGACAGGCCATGCATAGTC No data
Right 1073083035 10:100871772-100871794 CTGGAGGTTCCTGCATTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073083035 Original CRISPR CTGGAGGTTCCTGCATTGGA GGG Intergenic
No off target data available for this crispr