ID: 1073084668

View in Genome Browser
Species Human (GRCh38)
Location 10:100880396-100880418
Sequence TGTTATTTGCAGAACAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073084668_1073084673 29 Left 1073084668 10:100880396-100880418 CCATCCCTGTTCTGCAAATAACA No data
Right 1073084673 10:100880448-100880470 TGAGACACTGCAGATTTCTCTGG No data
1073084668_1073084674 30 Left 1073084668 10:100880396-100880418 CCATCCCTGTTCTGCAAATAACA No data
Right 1073084674 10:100880449-100880471 GAGACACTGCAGATTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073084668 Original CRISPR TGTTATTTGCAGAACAGGGA TGG (reversed) Intergenic
No off target data available for this crispr