ID: 1073084673

View in Genome Browser
Species Human (GRCh38)
Location 10:100880448-100880470
Sequence TGAGACACTGCAGATTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073084670_1073084673 24 Left 1073084670 10:100880401-100880423 CCTGTTCTGCAAATAACATTAGT No data
Right 1073084673 10:100880448-100880470 TGAGACACTGCAGATTTCTCTGG No data
1073084667_1073084673 30 Left 1073084667 10:100880395-100880417 CCCATCCCTGTTCTGCAAATAAC No data
Right 1073084673 10:100880448-100880470 TGAGACACTGCAGATTTCTCTGG No data
1073084668_1073084673 29 Left 1073084668 10:100880396-100880418 CCATCCCTGTTCTGCAAATAACA No data
Right 1073084673 10:100880448-100880470 TGAGACACTGCAGATTTCTCTGG No data
1073084671_1073084673 0 Left 1073084671 10:100880425-100880447 CCGTTTAGTGACTGTAATATTCC No data
Right 1073084673 10:100880448-100880470 TGAGACACTGCAGATTTCTCTGG No data
1073084669_1073084673 25 Left 1073084669 10:100880400-100880422 CCCTGTTCTGCAAATAACATTAG No data
Right 1073084673 10:100880448-100880470 TGAGACACTGCAGATTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073084673 Original CRISPR TGAGACACTGCAGATTTCTC TGG Intergenic
No off target data available for this crispr