ID: 1073085739

View in Genome Browser
Species Human (GRCh38)
Location 10:100887493-100887515
Sequence TTGAGGAAGAATGAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073085739_1073085748 22 Left 1073085739 10:100887493-100887515 CCTTGCTCCTCATTCTTCCTCAA No data
Right 1073085748 10:100887538-100887560 CCTGAGATAGAGGTTGTTCTGGG No data
1073085739_1073085743 -8 Left 1073085739 10:100887493-100887515 CCTTGCTCCTCATTCTTCCTCAA No data
Right 1073085743 10:100887508-100887530 TTCCTCAATTCATTAGGGCTTGG No data
1073085739_1073085746 21 Left 1073085739 10:100887493-100887515 CCTTGCTCCTCATTCTTCCTCAA No data
Right 1073085746 10:100887537-100887559 GCCTGAGATAGAGGTTGTTCTGG No data
1073085739_1073085745 12 Left 1073085739 10:100887493-100887515 CCTTGCTCCTCATTCTTCCTCAA No data
Right 1073085745 10:100887528-100887550 TGGAGTTTAGCCTGAGATAGAGG No data
1073085739_1073085750 28 Left 1073085739 10:100887493-100887515 CCTTGCTCCTCATTCTTCCTCAA No data
Right 1073085750 10:100887544-100887566 ATAGAGGTTGTTCTGGGAAAGGG No data
1073085739_1073085749 27 Left 1073085739 10:100887493-100887515 CCTTGCTCCTCATTCTTCCTCAA No data
Right 1073085749 10:100887543-100887565 GATAGAGGTTGTTCTGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073085739 Original CRISPR TTGAGGAAGAATGAGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr