ID: 1073094857

View in Genome Browser
Species Human (GRCh38)
Location 10:100973172-100973194
Sequence CTCAACACTGCTGCTGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 256}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073094846_1073094857 25 Left 1073094846 10:100973124-100973146 CCCAGAGCTCTCTGGGACCCGGC 0: 1
1: 0
2: 1
3: 16
4: 180
Right 1073094857 10:100973172-100973194 CTCAACACTGCTGCTGGAGGAGG 0: 1
1: 0
2: 3
3: 42
4: 256
1073094844_1073094857 26 Left 1073094844 10:100973123-100973145 CCCCAGAGCTCTCTGGGACCCGG 0: 1
1: 0
2: 2
3: 32
4: 245
Right 1073094857 10:100973172-100973194 CTCAACACTGCTGCTGGAGGAGG 0: 1
1: 0
2: 3
3: 42
4: 256
1073094851_1073094857 7 Left 1073094851 10:100973142-100973164 CCGGCACTTCAAGGGCCAAGCCC 0: 1
1: 1
2: 1
3: 18
4: 155
Right 1073094857 10:100973172-100973194 CTCAACACTGCTGCTGGAGGAGG 0: 1
1: 0
2: 3
3: 42
4: 256
1073094847_1073094857 24 Left 1073094847 10:100973125-100973147 CCAGAGCTCTCTGGGACCCGGCA 0: 1
1: 0
2: 3
3: 13
4: 185
Right 1073094857 10:100973172-100973194 CTCAACACTGCTGCTGGAGGAGG 0: 1
1: 0
2: 3
3: 42
4: 256
1073094852_1073094857 -8 Left 1073094852 10:100973157-100973179 CCAAGCCCAGAACTACTCAACAC 0: 1
1: 0
2: 0
3: 18
4: 156
Right 1073094857 10:100973172-100973194 CTCAACACTGCTGCTGGAGGAGG 0: 1
1: 0
2: 3
3: 42
4: 256
1073094850_1073094857 8 Left 1073094850 10:100973141-100973163 CCCGGCACTTCAAGGGCCAAGCC 0: 1
1: 0
2: 1
3: 22
4: 156
Right 1073094857 10:100973172-100973194 CTCAACACTGCTGCTGGAGGAGG 0: 1
1: 0
2: 3
3: 42
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073094857 Original CRISPR CTCAACACTGCTGCTGGAGG AGG Exonic
900504876 1:3024960-3024982 CTCACTGCTGCTGCTGGGGGCGG + Intergenic
901162758 1:7192605-7192627 ATCATCACTGCTCCTGCAGGTGG - Intronic
902294577 1:15457673-15457695 CTCCTTACTGCAGCTGGAGGAGG - Intronic
902297394 1:15477044-15477066 CTCTTTACTGCAGCTGGAGGAGG - Intronic
902511735 1:16970399-16970421 CTCAGCCCTGCGGCTGGAGAAGG + Exonic
902889609 1:19432640-19432662 CTCACAACAGCTGCAGGAGGTGG + Intronic
904014977 1:27412572-27412594 CTGAATTCTGCTGGTGGAGGAGG + Exonic
904277690 1:29394942-29394964 CTCAGCTCTGCTGGTGGATGAGG + Intergenic
904660940 1:32084298-32084320 CTCCAGACTGCAGCAGGAGGAGG - Intronic
904695098 1:32325733-32325755 ATCAACACTGCAGCTGGACACGG + Intronic
904834882 1:33329185-33329207 TTCATCACTGCTGCTAGAGATGG - Intronic
905248701 1:36632786-36632808 CTCAATACAGCTGTTGGAGGGGG - Intergenic
906196234 1:43932257-43932279 CAGAGAACTGCTGCTGGAGGTGG - Intergenic
907519996 1:55017371-55017393 CTTTTCTCTGCTGCTGGAGGTGG + Intergenic
908119318 1:60970984-60971006 CTCACCACAGCAGCTGGGGGCGG - Intronic
908764216 1:67539770-67539792 CTCAGCTCTGCTGCTGCAGTCGG - Intergenic
909140178 1:71854620-71854642 TTCCACACTGCTGGTGGTGGGGG + Intronic
909465239 1:75966584-75966606 CTCTATACTGCTGCTGCAGATGG - Intergenic
910072283 1:83231523-83231545 CATGACACAGCTGCTGGAGGAGG + Intergenic
910218638 1:84866931-84866953 CTCAACACGGCAGGTGGAGGAGG + Intronic
912701297 1:111880339-111880361 CTGACAACTGCTGCTGGAGGAGG + Intronic
913111590 1:115662044-115662066 TCCAACACTGCTGGTGGAAGTGG - Intronic
917856868 1:179108295-179108317 CTCATCACTGGTGGTGGGGGTGG + Exonic
919559693 1:199101403-199101425 CTGGAGACTGCAGCTGGAGGTGG + Intergenic
920999321 1:211026680-211026702 CTCATTACTGTTGGTGGAGGTGG - Intronic
921526251 1:216222274-216222296 CTCAACTCTGCTGCTGTAGCAGG + Intronic
922046042 1:221946942-221946964 CACCACACTGCTGCTGCAGGTGG + Intergenic
1062909713 10:1204859-1204881 CACAACACAGCTGCTGGCGAAGG - Intronic
1064019316 10:11796525-11796547 ATCAACTTTGCTGCTGAAGGGGG - Intergenic
1064122811 10:12634367-12634389 CTGAAAACAGCTGCTGTAGGAGG - Intronic
1064199482 10:13272481-13272503 CTCAACTGTGCCGCTGGAGCAGG - Intergenic
1064868039 10:19904487-19904509 CTCAATGCTGTTGCTGGGGGTGG - Intronic
1066984468 10:42453109-42453131 CTCTACACTGCTGGGAGAGGCGG - Intergenic
1067468870 10:46522062-46522084 CTGAACCCTACTGTTGGAGGTGG - Intergenic
1071082473 10:81828865-81828887 CTCTTCATTGCTGCTGGAAGAGG - Intergenic
1073094857 10:100973172-100973194 CTCAACACTGCTGCTGGAGGAGG + Exonic
1073631868 10:105157327-105157349 CTCGACACAGCTTCTGCAGGTGG - Intronic
1073996549 10:109322495-109322517 CACAACACTACTGTTGGAGGGGG + Intergenic
1074703226 10:116110303-116110325 CTCACCACTGCCTGTGGAGGAGG + Intronic
1075061282 10:119258748-119258770 CTCCACTCCCCTGCTGGAGGTGG - Intronic
1075103282 10:119520498-119520520 CTCAACTCTTCTGTTGAAGGTGG - Intronic
1075465335 10:122646704-122646726 CTCACCACAGCTGCCGGTGGTGG - Intergenic
1075685812 10:124364514-124364536 CCCACCACTGCTGCTGCAGGAGG - Intergenic
1075857054 10:125638432-125638454 CTCAACGCTGAAGCTGGAGAGGG + Intronic
1077347751 11:2071927-2071949 CTCCACACAGCGGCTGGGGGTGG + Intergenic
1080452571 11:32390645-32390667 CTTAACAGCACTGCTGGAGGTGG - Intronic
1082774652 11:57235982-57236004 CTCCCCACTGCTGCTGTGGGAGG + Exonic
1082858272 11:57828859-57828881 CACTCCACTGTTGCTGGAGGTGG - Intergenic
1082927633 11:58567592-58567614 TTCAACACGGCAGCTGCAGGAGG - Intronic
1083976588 11:66126901-66126923 TGCAACACTGCTGCGGGTGGAGG + Intronic
1084437967 11:69155165-69155187 CACATCACTGCTGATGGTGGGGG + Intergenic
1085064765 11:73484132-73484154 CTCAGCGCTGATGCTGGAAGTGG - Intronic
1089404502 11:118186448-118186470 CTCAGCCCTTCTGCTAGAGGTGG - Intergenic
1091799678 12:3316969-3316991 TGCGACAGTGCTGCTGGAGGTGG + Intergenic
1093490718 12:19701081-19701103 CACATCACTGCTGCTGGTGGTGG + Intronic
1095862272 12:46930887-46930909 CTCAGTACTGGTTCTGGAGGTGG - Intergenic
1096582347 12:52594173-52594195 CTCAACAGTGCTTTTTGAGGAGG - Intronic
1097983007 12:65753440-65753462 GCCAACAGTTCTGCTGGAGGAGG - Intergenic
1100613430 12:96211264-96211286 CTCAGCATTGCTGGTGGTGGAGG + Intronic
1101157173 12:101938877-101938899 CTCAACAATTCCTCTGGAGGGGG + Intronic
1101659461 12:106753047-106753069 CCCTACACTGCTGCTAGAGGAGG + Intronic
1103645587 12:122389853-122389875 GTCAACACCAGTGCTGGAGGGGG + Intronic
1103989071 12:124786232-124786254 CGCAGGACTGCTGCTGGAGGTGG + Intronic
1104276865 12:127337004-127337026 CCCACCTCTGCAGCTGGAGGTGG - Intergenic
1105812018 13:24003938-24003960 CAAAACAATGCTGCAGGAGGAGG - Intronic
1113016711 13:105836036-105836058 CTCAGAACTGCTGCTGTTGGTGG - Intergenic
1113976393 13:114231061-114231083 ATAATCCCTGCTGCTGGAGGTGG + Intergenic
1114016337 14:18433070-18433092 CACAACACTGCTGCTGGATTCGG - Intergenic
1114020844 14:18477270-18477292 CGGAACACTGCTGCTGGATTTGG - Intergenic
1114022572 14:18493842-18493864 CACAACACTGCTGCTGGATTCGG + Intergenic
1114024163 14:18509337-18509359 CAGAACACTGCTGCTGGATTCGG + Intergenic
1115620431 14:35135138-35135160 CACCACATTGCTGCTGCAGGGGG + Intronic
1116165558 14:41330102-41330124 TTCAATGCTGCTGCTGGATGCGG - Intergenic
1116941599 14:50796755-50796777 CTCCACACTGCTGCTGGGAAAGG - Intronic
1118678693 14:68216744-68216766 CTAATCCCTGCTGATGGAGGAGG - Intronic
1119031831 14:71198826-71198848 GTAATCACTACTGCTGGAGGTGG + Intergenic
1120313249 14:82858514-82858536 CTGAATACTGGTGCTGGTGGGGG - Intergenic
1120569024 14:86094979-86095001 CTCAACACAGCTCCTTGATGTGG + Intergenic
1121017539 14:90557634-90557656 CTCAGTGTTGCTGCTGGAGGTGG - Intronic
1121885921 14:97542589-97542611 TTTCAAACTGCTGCTGGAGGAGG + Intergenic
1122695822 14:103551546-103551568 GCCACCACTGCTGCTGGAGCCGG - Intergenic
1122876530 14:104668732-104668754 CTCAATGCTGCTGCAGGAGGAGG + Intergenic
1123194213 14:106600982-106601004 CTCACCACTAGTGCTGGAGGAGG - Intergenic
1123437715 15:20267712-20267734 CTCAGCACTTTTGCTGGAGGTGG + Intergenic
1123783384 15:23646937-23646959 GTCATCATGGCTGCTGGAGGCGG + Exonic
1124377993 15:29140774-29140796 CTCAACTCTGCACCTGGAGGTGG + Intronic
1124446408 15:29738089-29738111 CACTACACTGATGCTAGAGGTGG - Intronic
1125930240 15:43594703-43594725 CACAACACTACGGATGGAGGAGG - Intronic
1125943408 15:43694535-43694557 CACAACACTACGGATGGAGGAGG - Intronic
1129279539 15:74473464-74473486 CTGAACACTGCTGGGGGAGAGGG - Intergenic
1130560450 15:84954162-84954184 CTCAACAATGGGTCTGGAGGAGG - Intergenic
1131410757 15:92205730-92205752 CACACCACTGCTGCAGGGGGAGG + Intergenic
1134582482 16:15382279-15382301 CTCACCACTTCTGCTGAGGGAGG + Intergenic
1135436443 16:22429763-22429785 TTAAACATTGATGCTGGAGGAGG - Intronic
1135862179 16:26066639-26066661 CTCAACACTGCAGCTGCTGGTGG - Intronic
1136846860 16:33583143-33583165 CTCAGCACTTTTGCTGGAGGTGG - Intergenic
1137967532 16:52951635-52951657 CTCAACATTGGTGGTGGAGAAGG + Intergenic
1138185245 16:54971779-54971801 CTAGATACTGCTGCTGGAGTAGG + Intergenic
1138419473 16:56889967-56889989 CTCAACTCTGCCCATGGAGGTGG - Intronic
1138555596 16:57769618-57769640 CTTCCCACTGCTGCTGCAGGAGG - Exonic
1138953644 16:61944409-61944431 CTAAATACTGCTGGGGGAGGTGG + Intronic
1139240114 16:65382745-65382767 CTCAACTCTCCTGCAGGTGGGGG + Intergenic
1140263018 16:73396961-73396983 CTTAACACTGATCCTGTAGGTGG + Intergenic
1140528097 16:75640822-75640844 CTCAACTCTGCTGTTTCAGGGGG + Intronic
1141177975 16:81733148-81733170 CTCAAGTCTTCTGTTGGAGGTGG + Intergenic
1142236959 16:88926947-88926969 CTCCTCACTGGTCCTGGAGGTGG + Intronic
1203108568 16_KI270728v1_random:1431798-1431820 CTCAGCACTTTTGCTGGAGGTGG - Intergenic
1142891724 17:2948282-2948304 CTCTCCTCTGCTTCTGGAGGTGG - Intronic
1144873224 17:18382989-18383011 CCCCACCCTGCTGCTGGCGGCGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1144951382 17:18996281-18996303 CCCAACCGTGCTGCTGGAGGAGG - Intronic
1147720516 17:42536769-42536791 GGCCACACAGCTGCTGGAGGCGG - Intronic
1148194974 17:45706761-45706783 CTCCACTTTGCTGCTGGAGAGGG - Intergenic
1148576838 17:48718485-48718507 CTCTACAGGGCTGCGGGAGGGGG + Intergenic
1148705051 17:49622767-49622789 CTCGACATTTCTGCCGGAGGTGG + Exonic
1148938046 17:51180671-51180693 GACAACACTGCAGCTGAAGGAGG - Exonic
1149031768 17:52091715-52091737 ATGAACATTGCTGTTGGAGGGGG + Intronic
1149696590 17:58621152-58621174 CCCATCACAGCTGCAGGAGGTGG - Intronic
1150158151 17:62871343-62871365 CCCAACACTTTTGCTGGTGGGGG - Intergenic
1150648285 17:66993343-66993365 GTCATCACTGGTGCTGGAAGAGG + Intronic
1150982296 17:70156151-70156173 CTCAACTCTGCTGTTGCAGCTGG + Intergenic
1151748017 17:76022042-76022064 CCCCACCCTGCTGCTGGCGGCGG - Intronic
1152649978 17:81488262-81488284 CTCCACCCGGCAGCTGGAGGAGG - Intergenic
1155310076 18:24514841-24514863 CTCAACTGTGCTGCTGGAGCAGG - Intergenic
1155577072 18:27259583-27259605 CTGAACACACCTGCAGGAGGTGG + Intergenic
1156278706 18:35611080-35611102 TTCAGAACTGCTGCTGTAGGTGG + Intronic
1159780297 18:72653163-72653185 CTCCACAGTGCTCCTGCAGGGGG + Intergenic
1159971273 18:74657709-74657731 GTAAACACTGCTGCTGCAGTGGG - Intronic
1160458708 18:79021150-79021172 CTCAACACAGCTGCCCCAGGTGG + Intergenic
1160583306 18:79899847-79899869 CCCGACGCTGCAGCTGGAGGGGG - Intronic
1161959995 19:7517897-7517919 CAGAATGCTGCTGCTGGAGGGGG + Intronic
1165033693 19:33017607-33017629 CTCAGCACTTTTACTGGAGGTGG + Intronic
925748177 2:7062658-7062680 CTCACCACTGATACTGGAGCAGG + Intronic
926055121 2:9769858-9769880 CTCAGCACAGTTGCTGGTGGGGG - Intergenic
926073803 2:9923904-9923926 ACCAACTCTGCAGCTGGAGGAGG - Intronic
926150599 2:10423565-10423587 CTCCACAGAGCTGCTGTAGGTGG - Intronic
928395096 2:30937571-30937593 CCGACCACGGCTGCTGGAGGGGG - Intronic
928947950 2:36789150-36789172 CTCCACCCTGCTGCTGGGGGAGG - Intronic
929170329 2:38926166-38926188 CTCCATCCTGCCGCTGGAGGCGG - Intronic
929489536 2:42384105-42384127 CTCCACACTGGTGGTAGAGGAGG - Intronic
930663312 2:54077500-54077522 TGCAGCACGGCTGCTGGAGGTGG + Intronic
931458803 2:62432950-62432972 CAGACCACTGCTGCTGGAAGAGG + Intergenic
932760485 2:74436327-74436349 CTGAGCGCTGCAGCTGGAGGCGG - Intronic
934755626 2:96822694-96822716 CTCCTCACTGCTGTTGGAGCTGG - Intronic
934779981 2:96963772-96963794 GTCAACTCTGCTGCTGCAGCAGG - Intronic
934982679 2:98858269-98858291 CCCAACACTGCTGAGGCAGGCGG + Intronic
935057494 2:99580344-99580366 CTCAACTCTGCTGTTGTAGCAGG - Intronic
935135911 2:100301565-100301587 CTCAACAGAGCTGCTGGAGATGG + Intronic
935237253 2:101149825-101149847 CTCAAAACAGCTCCTGGAGCAGG + Intronic
936743493 2:115544787-115544809 TTCCTCACTGCTGCTGGTGGTGG + Intronic
937808366 2:126171582-126171604 CACAGCACTGGTGCTGGATGGGG + Intergenic
938099174 2:128486541-128486563 CTCACCGCTGCTGCTGAATGAGG + Intergenic
942282450 2:174379479-174379501 CTCAACTCTGCTGCTGCAGTGGG + Intronic
942518134 2:176774614-176774636 CTCCACACTGCTGCCAGAGTGGG - Intergenic
942570652 2:177310765-177310787 GGCAAAACAGCTGCTGGAGGTGG + Intronic
942992734 2:182221220-182221242 TCTAACACTGCTGCTGGAAGAGG + Intronic
943665333 2:190602935-190602957 TTATATACTGCTGCTGGAGGTGG + Intergenic
944363742 2:198892035-198892057 CTGAACACACCTGCAGGAGGTGG - Intergenic
945357482 2:208857104-208857126 CTGAACACTGCAGTTGGTGGTGG - Intergenic
947752591 2:232540589-232540611 CGCACCACTGCTGCAGGGGGAGG - Exonic
948305669 2:236945139-236945161 CCCAACTCTCCTGCAGGAGGTGG - Intergenic
948396253 2:237647520-237647542 CTCAACCCTGCTGCAGGGTGGGG - Intronic
948586877 2:239025447-239025469 CTCGGCTCTGCTGCTGGGGGTGG - Intergenic
1170603572 20:17859720-17859742 ATCCTCTCTGCTGCTGGAGGGGG + Intergenic
1172510373 20:35496847-35496869 CTCAACACCCCTACAGGAGGGGG + Intronic
1173421116 20:42901932-42901954 CTCAACTCTGCTGCTGTAGCTGG - Intronic
1173544338 20:43882093-43882115 CTCAATAATGCTGCTTCAGGTGG - Intergenic
1173565681 20:44036716-44036738 CTCAATTCTGCTGCAGGAGCAGG - Intronic
1174371566 20:50092362-50092384 CTCAACAGTGCTCCTCGATGAGG + Intronic
1174511874 20:51059630-51059652 ATCAACACAGCTGCTTGAGCTGG - Intergenic
1175136934 20:56831216-56831238 CCCAACACTGCTGCTGGATGTGG + Intergenic
1175704978 20:61170093-61170115 CTCAAAGCTGCTGCTGGTTGTGG - Intergenic
1175940652 20:62536158-62536180 CTCAGCACTGCTGGGGGTGGAGG - Intergenic
1176979017 21:15357860-15357882 CTCAACACTGGTGCTGGTGAAGG - Intergenic
1178579106 21:33822153-33822175 GTCAACACTGGCGCTGAAGGAGG + Intronic
1179170938 21:38972289-38972311 CTCAATACAGCTGCTTGGGGTGG + Intergenic
1179236815 21:39554739-39554761 CTCAGCACTGCAGGTGCAGGGGG + Intergenic
1179640793 21:42746069-42746091 CTCACTCCTGCTGCTGTAGGTGG - Intronic
1180010338 21:45045619-45045641 CTCATCATTGCTGCTGGAAATGG + Intergenic
1180028296 21:45181530-45181552 CTCACCCATGCTGCTGGAAGAGG - Intronic
1180440844 22:15363943-15363965 CACAACACTGCTGCTGGATTCGG - Intergenic
1180445332 22:15407856-15407878 CGGAACACTGCTGCTGGATTTGG - Intergenic
1180446616 22:15420256-15420278 CACAACACTGCTGCTGGATTCGG + Intergenic
1180448328 22:15436820-15436842 CAGAACACTGCTGCTGGATTCGG + Intergenic
1181050935 22:20237897-20237919 CTCCTCACTGTGGCTGGAGGCGG + Intergenic
1181321082 22:22006843-22006865 CTCAAAACTGTTGCTGAATGAGG - Intergenic
1181720250 22:24768716-24768738 CGCAACTCTGCAGGTGGAGGAGG + Intronic
1182526988 22:30926743-30926765 CTCAACCCTGTAGCTGCAGGGGG - Exonic
1182698570 22:32212477-32212499 GTCAGCCCTGCTGCTGGGGGTGG + Intergenic
1183134440 22:35872955-35872977 CTTAATACTGCTACGGGAGGGGG - Intronic
1185026612 22:48417735-48417757 CTCACCCCGGCAGCTGGAGGTGG + Intergenic
1185043528 22:48517726-48517748 CTCACCGCGGCTGCTGGATGTGG - Intronic
950276595 3:11666439-11666461 CTCCACGCTGGTGCTGGAGTGGG - Intronic
951676740 3:25250074-25250096 GTCCACACTGGTGCTGGTGGTGG + Intronic
951739465 3:25904516-25904538 CTCAACAGTCCTGCTGGTGCTGG + Intergenic
952129684 3:30346795-30346817 CTTAACACTGCACATGGAGGGGG - Intergenic
953343973 3:42159974-42159996 CTCCTCATTGCTGCTGGGGGAGG + Intronic
953929800 3:47000201-47000223 GGCAACACTGCTGGTGGTGGCGG + Exonic
954344947 3:49988968-49988990 CTCAACACAGCTCCTGGACAAGG - Intronic
954616087 3:51969401-51969423 CCCAGCACTGCTGCAGGGGGTGG - Exonic
956027203 3:64995951-64995973 CTCAAAACAGCTGCAGGGGGTGG - Intergenic
956202448 3:66720433-66720455 TTCAACAGTCTTGCTGGAGGTGG - Intergenic
956787118 3:72651967-72651989 CTCCACAGTGCTGATGGTGGTGG - Intergenic
958699585 3:97570909-97570931 CTCTACAGTGCTGGTGGAAGGGG - Intronic
960569454 3:119171311-119171333 GTCTACACTGCTGCTGGTGGTGG + Intronic
960596852 3:119414838-119414860 ATTAGCACAGCTGCTGGAGGAGG - Exonic
960908826 3:122628317-122628339 CTCCACACTTCAGCTAGAGGGGG + Intronic
961323497 3:126095284-126095306 CTCAACACGGCTGCAACAGGGGG - Intronic
961974782 3:131012057-131012079 CTTATTACTTCTGCTGGAGGAGG + Intronic
964745758 3:160011017-160011039 CTCAAAACAGCTGCAGGAGATGG + Intergenic
968864491 4:3199115-3199137 CTGAACACAGCTCCTGGAGAAGG - Intronic
970783477 4:19767782-19767804 ATCAGCTCTGCTGCTGGAGGAGG + Intergenic
978612994 4:110565325-110565347 CTCAGCACTGCTGTTGTAGCAGG - Intergenic
982771443 4:159400810-159400832 CTCAAAGATGCTGCTGGATGAGG + Intergenic
989421210 5:41241190-41241212 GGCAACCTTGCTGCTGGAGGCGG + Intronic
989632581 5:43501109-43501131 CTCAAAGCTGTTGCGGGAGGGGG - Intronic
991193035 5:63897775-63897797 TTCATCACTACTGCTGGATGTGG - Intergenic
992434928 5:76746855-76746877 ATCAGCACCCCTGCTGGAGGAGG - Intergenic
995244480 5:109920908-109920930 CTCATCCCTGCAGCTGCAGGAGG + Intergenic
997349743 5:133222138-133222160 CTCAGCACAGACGCTGGAGGCGG - Intronic
1000108087 5:158079866-158079888 CTCATCACTGCAGGTGGAGGTGG + Intergenic
1001493402 5:172171361-172171383 CTCACAACAGCTTCTGGAGGAGG - Intronic
1002583742 5:180227921-180227943 ACCAACTCTGCTGATGGAGGTGG - Intergenic
1002912887 6:1504668-1504690 CCCAGCAGTGCTGCCGGAGGTGG + Intergenic
1003000721 6:2330076-2330098 TTCCACAGTGCTGCAGGAGGAGG - Intergenic
1003244925 6:4375534-4375556 ATCATCACTGCTGCAGGAGATGG - Intergenic
1005840751 6:29743340-29743362 CCCAAGACAGCTCCTGGAGGAGG + Intergenic
1006506032 6:34489416-34489438 CCCAGCACTGCTGCTGGATGGGG - Intronic
1006509408 6:34513767-34513789 CTCAGCTCTGCTGCTGAAGGGGG - Intronic
1006743114 6:36323288-36323310 CTCACCAAGGCTGCTGGAGGTGG + Exonic
1006743675 6:36326505-36326527 CTCACCATAGCTGCTGGAGATGG + Exonic
1008147056 6:47904434-47904456 CTCAACTCTGCTATTGTAGGGGG - Intronic
1008177734 6:48288964-48288986 CACATTACTGCTGCTGGGGGTGG + Intergenic
1011901236 6:92301332-92301354 CACAACACTGCTGCCAGTGGTGG - Intergenic
1013188380 6:107781866-107781888 CTCAACTCTGTTGTTGGATGGGG + Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1015349291 6:132197913-132197935 CTTAAGCCTGCTGCTGGAGCTGG + Intergenic
1015785291 6:136916894-136916916 CTCAACACAGCTGCCGGAGACGG + Intergenic
1018473994 6:164122445-164122467 CTCACCACTGCTCCTGGCTGGGG - Intergenic
1018716970 6:166540832-166540854 TTCCACGCGGCTGCTGGAGGTGG + Intronic
1018935684 6:168272528-168272550 CCCAACACTCCTGCTGGAGGCGG + Intergenic
1019394607 7:810759-810781 GTGATCCCTGCTGCTGGAGGTGG - Intergenic
1019778701 7:2927326-2927348 CGCAACACAGCTGCTGGTGGAGG + Intronic
1020002440 7:4763555-4763577 CTCACCACTGCTGCTGGGGTGGG - Exonic
1024299060 7:47872170-47872192 CTCCAGACTCCTGCTGCAGGGGG - Intronic
1025207109 7:57000278-57000300 CTCAGCCCTGCCTCTGGAGGTGG + Intergenic
1026530291 7:71191458-71191480 CTCAACTCTGCTGTTGCAGCAGG + Intronic
1027256868 7:76436543-76436565 CACAAGGCAGCTGCTGGAGGAGG - Intronic
1027281979 7:76615484-76615506 CACAAGGCAGCTGCTGGAGGAGG + Intronic
1027289998 7:76696495-76696517 CATGACACAGCTGCTGGAGGAGG + Intergenic
1028889470 7:95970943-95970965 TTCAAGACAGATGCTGGAGGTGG + Intronic
1030108871 7:106009589-106009611 GTCAGCGCGGCTGCTGGAGGCGG + Intronic
1030205939 7:106952858-106952880 CACAAAACTGCTCCAGGAGGAGG - Intergenic
1032840319 7:135708205-135708227 CACCACGCTGCTGCTGGTGGGGG - Exonic
1033851540 7:145502238-145502260 CTCATTACTGCTGCGGGAGGGGG + Intergenic
1034644644 7:152634129-152634151 CGGCACACTGCTGCTGGAGGTGG + Intergenic
1035557521 8:577988-578010 CTCACCCCTGCTGCATGAGGTGG - Intergenic
1036089526 8:5650342-5650364 CACAGCACTGATGCTGGGGGTGG + Intergenic
1036795942 8:11756995-11757017 CTCCTCGCTGCTGCTGGTGGTGG - Exonic
1036913805 8:12785385-12785407 GGCAGCCCTGCTGCTGGAGGGGG + Intergenic
1037705862 8:21314510-21314532 CTCTTCCCTGCTGCTGGAAGGGG + Intergenic
1039022506 8:33223386-33223408 ATCAGCACTTCTGCTAGAGGTGG + Intergenic
1040079857 8:43275241-43275263 CTCAAGGCTGGGGCTGGAGGAGG - Intergenic
1040518483 8:48153940-48153962 CTCCTCATTACTGCTGGAGGGGG - Intergenic
1041291929 8:56316196-56316218 CTCATCACAGGTGCTGGAAGTGG - Exonic
1043396561 8:79843054-79843076 CTGAACACACCTGCAGGAGGTGG - Intergenic
1044747550 8:95385382-95385404 CCCAACAGTGCTGCTGGGGCAGG - Intergenic
1045147330 8:99361395-99361417 CTCAACTCTGCTGCTTTAGCAGG + Intronic
1048046936 8:130781408-130781430 CTCCACACTGCTGCAGGAGCGGG + Intronic
1048757293 8:137754074-137754096 CTCCAGACTGCTGCTGCCGGGGG - Intergenic
1049244436 8:141554465-141554487 CTGAACACTGCACTTGGAGGAGG + Intergenic
1049713331 8:144077425-144077447 CACAACCCTGCTGCTGCAGCTGG - Intergenic
1050075466 9:1858119-1858141 AGCAGCTCTGCTGCTGGAGGGGG - Intergenic
1050654563 9:7812455-7812477 CTTAACCCTGCTGCTGGACAAGG - Intronic
1053131797 9:35619461-35619483 CTCCCCACAGCTGCAGGAGGGGG - Intronic
1055325149 9:75120933-75120955 CTGACCACTCCAGCTGGAGGTGG + Intronic
1055505561 9:76944840-76944862 CTCAACACTTCTACTGGTGCTGG + Intergenic
1055648067 9:78379428-78379450 CTCAACTCTGCTGAAGCAGGGGG + Intergenic
1056366421 9:85909441-85909463 CTCACCACTGCTGCTAGAGGAGG - Intergenic
1057016731 9:91658633-91658655 CTCCACACAGCTGCTGGGGGCGG + Intronic
1057085247 9:92203995-92204017 CTTAACACAGCTGCTGAAAGTGG - Intergenic
1059043943 9:110843874-110843896 CTCGACACAGCTGGAGGAGGAGG - Intergenic
1060118975 9:120970315-120970337 GGCAACACTGCTGCTGCAGATGG + Intronic
1060498276 9:124133850-124133872 CTCAGCACTGTGCCTGGAGGCGG + Intergenic
1061397026 9:130348915-130348937 CTCATTACTGATGCTGGGGGTGG + Intronic
1062091992 9:134683189-134683211 CTCAGCACTGCCACGGGAGGAGG - Intronic
1185589459 X:1264721-1264743 CTCACCAAGGCTGCTGGAAGTGG - Intergenic
1186310205 X:8309593-8309615 CTCAACTCAGCTGTTGTAGGAGG + Intergenic
1186406796 X:9311620-9311642 CTCCTCTCTGCAGCTGGAGGTGG - Intergenic
1187084191 X:16024719-16024741 CTCCACAGTGCTGAGGGAGGAGG + Intergenic
1189197862 X:39166883-39166905 CTCAGCACTCCAGCAGGAGGAGG - Intergenic
1189302334 X:39961008-39961030 TCCTACACTGCTGATGGAGGTGG + Intergenic
1190136488 X:47804097-47804119 CTGAATTCTGCTGGTGGAGGAGG - Intergenic
1192981650 X:76350632-76350654 CTCACCACTACTACTGGAGCTGG + Intergenic
1193042741 X:77020845-77020867 TTGAACACTGCTGAAGGAGGTGG - Intergenic
1195772763 X:108369835-108369857 CTCAACTCTGCTGTTGCAGGGGG + Intronic
1197226951 X:123963108-123963130 GTCAGCACCGCTGCTGGGGGCGG + Intronic
1198312976 X:135438251-135438273 CTCAGCCCTGCAGCTGGAGAAGG + Intergenic
1199196539 X:145037672-145037694 CTCTAGGCTACTGCTGGAGGGGG + Intergenic
1199358192 X:146885866-146885888 CACCACACTGCTGCTGCTGGGGG - Intergenic
1200656501 Y:5909443-5909465 CACCACACTGCTGCTGTTGGCGG - Intergenic
1201222941 Y:11789411-11789433 CTCAGCACTGGAGCTGGAAGAGG + Intergenic