ID: 1073095643

View in Genome Browser
Species Human (GRCh38)
Location 10:100978125-100978147
Sequence GGCCATAAGGTCATTCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073095637_1073095643 17 Left 1073095637 10:100978085-100978107 CCACTTGCAGATTTGGAACTCCA 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1073095643 10:100978125-100978147 GGCCATAAGGTCATTCTCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1073095639_1073095643 -3 Left 1073095639 10:100978105-100978127 CCAAACATACATTGTTTTGAGGC 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1073095643 10:100978125-100978147 GGCCATAAGGTCATTCTCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073095643 Original CRISPR GGCCATAAGGTCATTCTCAG GGG Intronic
902476582 1:16691687-16691709 GGGCTGAAGGTCCTTCTCAGGGG - Intergenic
905195031 1:36269442-36269464 GTCCAAAATGTCATTCCCAGTGG - Intronic
905594375 1:39193467-39193489 GGGCATCAAGTCATCCTCAGTGG - Intronic
908087546 1:60652443-60652465 GGCCATAACACCATACTCAGAGG + Intergenic
909931799 1:81505361-81505383 GGCCAGTATGTCTTTCTCAGGGG + Intronic
911450517 1:98054590-98054612 GGCCATAATTTCTTTTTCAGGGG - Intergenic
912867520 1:113271217-113271239 GGCCATAAAGTTATGGTCAGTGG - Intergenic
916650027 1:166826207-166826229 AGCTATGAGGTCATTGTCAGTGG + Intergenic
917486646 1:175461021-175461043 AGCCAGAAGGGCATTCCCAGTGG + Intronic
923723670 1:236487823-236487845 AGCCACAAGGCCATTCTCGGTGG + Intergenic
1062782753 10:230896-230918 GTCCATAATGTCAATTTCAGCGG - Intronic
1070713368 10:78699770-78699792 GGCAATAATGTCATTCCCATAGG + Intergenic
1071206239 10:83282374-83282396 AGCCATAAGGTAACTCTCTGGGG + Intergenic
1073095643 10:100978125-100978147 GGCCATAAGGTCATTCTCAGGGG + Intronic
1074220639 10:111434290-111434312 GGCCTGGAGGTCATTCTAAGAGG + Intergenic
1075310965 10:121413030-121413052 GGCCATGAGGACACTCACAGGGG + Intergenic
1076343093 10:129763278-129763300 GGCCCTAAGGACATTTTCAAAGG - Intronic
1081406783 11:42707572-42707594 AGCTATTAGGTCATTCACAGGGG + Intergenic
1084649022 11:70477537-70477559 GGCAATAAGCTGCTTCTCAGTGG - Intronic
1085036048 11:73300722-73300744 GGCAATAGGGTCATTCAGAGAGG + Intergenic
1090001713 11:122966529-122966551 GGCCATCAGCTCATTTTCAGAGG - Intergenic
1090906340 11:131077609-131077631 TGCCATAAGATCATACACAGAGG + Intergenic
1091554252 12:1560375-1560397 TCCCCTAAGGTCATTTTCAGAGG + Intronic
1093322514 12:17730966-17730988 GGCCATATGGTAATTCTATGAGG - Intergenic
1097567119 12:61285025-61285047 GCCCATTTGGTCTTTCTCAGAGG - Intergenic
1097907946 12:64939855-64939877 GGACAAAAGGTCATTCTAGGAGG + Intergenic
1098218318 12:68242809-68242831 GGCCCTAATTTCATTGTCAGGGG - Intergenic
1101594986 12:106156160-106156182 GGCCATCAGGTCAAGGTCAGGGG - Intergenic
1102825387 12:115944103-115944125 GGAGCCAAGGTCATTCTCAGTGG - Intergenic
1104534430 12:129605527-129605549 GGGCATAAGATCATTCCAAGGGG - Intronic
1105443648 13:20435153-20435175 GGCATTAAGGACATTCTCACTGG - Intronic
1111752117 13:92346035-92346057 GGTCATTAGGTCATGCTCTGAGG - Intronic
1112485228 13:99813839-99813861 GGCTATGATGTGATTCTCAGAGG - Intronic
1112951003 13:104996909-104996931 GAAAAGAAGGTCATTCTCAGGGG + Intergenic
1116135240 14:40914903-40914925 GGCCAGGAGGCCATTCTCGGGGG + Intergenic
1122871649 14:104641477-104641499 GGCCACAAGGACCTTCCCAGTGG + Intergenic
1124646954 15:31444010-31444032 GGCCATGAGGTCATAGTCTGAGG - Intergenic
1129295460 15:74597666-74597688 GGCCAGTATGTCTTTCTCAGGGG + Exonic
1129633995 15:77295143-77295165 AGCCATAAGGTCACCCTGAGTGG - Intronic
1130408207 15:83622139-83622161 GGGCATAAGGTCTGCCTCAGAGG - Intergenic
1132213811 15:100047795-100047817 GTCCATCAGGTCATATTCAGGGG - Intronic
1132611615 16:819579-819601 GGCCACAAGGACATGCTCAGAGG - Intergenic
1137353992 16:47740543-47740565 GGCCATAAAATAAGTCTCAGCGG + Intergenic
1146952030 17:36913466-36913488 GGGCAGAAGGGCATGCTCAGGGG - Intergenic
1157753228 18:50196038-50196060 CCCCAGAAGGTGATTCTCAGAGG + Intergenic
1159578098 18:70204549-70204571 GACCATAAGGTGAGTGTCAGTGG - Intronic
1160062083 18:75539981-75540003 GGAAATAAGGAAATTCTCAGAGG + Intergenic
1162472737 19:10882227-10882249 GCCCACAAGTTCATTCCCAGAGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1202710603 1_KI270714v1_random:17528-17550 GGGCTGAAGGTCCTTCTCAGGGG - Intergenic
925296950 2:2783592-2783614 GGGCTGCAGGTCATTCTCAGAGG - Intergenic
931303925 2:61009047-61009069 AGCCTTAAGGACATTGTCAGTGG - Intronic
933551404 2:83781609-83781631 AGCCATAAAGTCTTTTTCAGGGG - Intergenic
936487890 2:112942424-112942446 GCCCATAAGGCCAGTCTCAAGGG - Intergenic
937962222 2:127469032-127469054 AGCAACAAGGTCAGTCTCAGTGG - Intronic
938309166 2:130275377-130275399 AGCCATATAGTCATTCTAAGTGG - Intergenic
940159852 2:150699851-150699873 GACCATAAGGCGATTCTTAGAGG + Intergenic
941641082 2:167989149-167989171 GGCTTTAAGCTCATTCCCAGTGG + Intronic
945916190 2:215706395-215706417 GGCCAGAAGCTCTTTCTGAGCGG + Intergenic
1169545520 20:6646488-6646510 GTCCAGAAGTTCATTTTCAGTGG + Intergenic
1182881886 22:33740765-33740787 AGCCACAAGATCATTCTCAAAGG + Intronic
1183168952 22:36170341-36170363 GAACATAGGGCCATTCTCAGGGG + Intergenic
949576588 3:5344552-5344574 GCCCAAATGGTCATTCACAGTGG - Intergenic
952701131 3:36328782-36328804 GGCCAGAAACTTATTCTCAGTGG - Intergenic
955608816 3:60735380-60735402 GGTCATTTGCTCATTCTCAGTGG - Intronic
957615482 3:82520730-82520752 GGCCAGGAGGTCATTTTCTGTGG + Intergenic
961319181 3:126061170-126061192 GGCCAGATGGTCATTCTTACAGG + Intronic
967201624 3:187077086-187077108 GGACTTAACGTCACTCTCAGAGG + Exonic
967813338 3:193779158-193779180 AGCAATGAGGACATTCTCAGGGG - Intergenic
967845532 3:194039678-194039700 TTTCATAAGTTCATTCTCAGAGG - Intergenic
971077528 4:23167226-23167248 GGCCATAAGGAAATCCTCATTGG + Intergenic
977681241 4:99800766-99800788 GGCCATGAGCTCAATTTCAGGGG + Intergenic
979314853 4:119249949-119249971 GGACATAAGGCCAGTCGCAGTGG - Intronic
984731872 4:183076001-183076023 GGCCATCAGTTCATCCTCACGGG + Intergenic
986006993 5:3676859-3676881 GACCAGGAAGTCATTCTCAGGGG - Intergenic
987900454 5:24004012-24004034 GGTCATATGGTCATTCACAAGGG + Intronic
993605796 5:89989448-89989470 GGCCAAGAGGCCATTCTCAGAGG - Intergenic
994146354 5:96400120-96400142 GGCCAGCGGGTCATACTCAGAGG + Exonic
999479108 5:151929000-151929022 GTCCATAATGGCATTCACAGAGG + Intergenic
1000940706 5:167356590-167356612 GGCCATTTGGCCATTATCAGAGG - Intronic
1002921215 6:1574746-1574768 GGCCATCAGGTCATTATATGGGG - Intergenic
1010550505 6:77216572-77216594 GGGCATAATGGCATCCTCAGAGG + Intergenic
1017191219 6:151654700-151654722 GCCCAGAAGGCCGTTCTCAGAGG + Intergenic
1018541868 6:164889534-164889556 GGCCATAATTTTATTCTCATGGG + Intergenic
1019403064 7:867425-867447 GGCCATAACATCCTTCTCACAGG + Intronic
1026077995 7:67190950-67190972 GGCCATAAAGTCTTCCTCACTGG - Intronic
1028121537 7:87060446-87060468 GGACATAAGGCCTTCCTCAGTGG + Intergenic
1030424681 7:109359576-109359598 GGACATAAGGGAATTTTCAGTGG - Intergenic
1030830514 7:114214233-114214255 TACCTTAAGGTCACTCTCAGGGG + Intronic
1032830110 7:135614986-135615008 TGCCATTAGATAATTCTCAGAGG - Intronic
1033293717 7:140112117-140112139 GACAATAAGGTCTTTCACAGTGG + Intronic
1035672042 8:1425657-1425679 TGCCATCAGGGCAGTCTCAGGGG - Intergenic
1046417176 8:113932753-113932775 AGCCTTAAGATCTTTCTCAGTGG - Intergenic
1052387207 9:27836000-27836022 GGGAATAAGATCATTCTCAGAGG + Intergenic
1057727353 9:97577333-97577355 TGCCTTCTGGTCATTCTCAGAGG + Intronic
1188631982 X:32374951-32374973 GGAAATAAGATCATTTTCAGAGG + Intronic
1189351485 X:40279016-40279038 GGCCATGATGTCATTCACACAGG + Intergenic
1189429128 X:40931774-40931796 GCCCACTTGGTCATTCTCAGGGG - Intergenic
1196079574 X:111617056-111617078 GGTCTCAAGGTCCTTCTCAGTGG - Intergenic
1196098164 X:111821765-111821787 GGCCCAAAGGTCATTGTCTGAGG - Intronic
1197442473 X:126509146-126509168 GCAAATAAGGTCACTCTCAGTGG - Intergenic
1197635806 X:128913794-128913816 GGCAATCAGGTCATTCTAGGTGG + Intergenic
1199196504 X:145037397-145037419 GGCCATAAGGACAAACTCATAGG - Intergenic