ID: 1073095750

View in Genome Browser
Species Human (GRCh38)
Location 10:100978723-100978745
Sequence CAGGCTCACCTGGGGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073095750_1073095759 9 Left 1073095750 10:100978723-100978745 CCCCAAATCCCCAGGTGAGCCTG 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1073095759 10:100978755-100978777 TTCCTGTGTGTTGTCAAGTGAGG 0: 1
1: 0
2: 0
3: 15
4: 161
1073095750_1073095760 10 Left 1073095750 10:100978723-100978745 CCCCAAATCCCCAGGTGAGCCTG 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1073095760 10:100978756-100978778 TCCTGTGTGTTGTCAAGTGAGGG 0: 1
1: 0
2: 0
3: 19
4: 139
1073095750_1073095763 28 Left 1073095750 10:100978723-100978745 CCCCAAATCCCCAGGTGAGCCTG 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1073095763 10:100978774-100978796 GAGGGGTCAGCCTCAGAGTGAGG 0: 1
1: 1
2: 1
3: 25
4: 240
1073095750_1073095762 11 Left 1073095750 10:100978723-100978745 CCCCAAATCCCCAGGTGAGCCTG 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1073095762 10:100978757-100978779 CCTGTGTGTTGTCAAGTGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 180
1073095750_1073095764 29 Left 1073095750 10:100978723-100978745 CCCCAAATCCCCAGGTGAGCCTG 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1073095764 10:100978775-100978797 AGGGGTCAGCCTCAGAGTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073095750 Original CRISPR CAGGCTCACCTGGGGATTTG GGG (reversed) Intronic
900439885 1:2649240-2649262 GATGCTCACCTGGGGTTGTGGGG - Intronic
900440086 1:2650495-2650517 CATGCTCACCTGGGGTAGTGGGG - Intronic
900440114 1:2650657-2650679 GATGCTCACCTGGGGGTGTGGGG - Intronic
900440165 1:2650940-2650962 GATGCTCACCTGGGGGGTTGGGG - Intronic
900440203 1:2651102-2651124 GTTGCTCACCTGGGGGTTTGGGG - Intronic
900441256 1:2656570-2656592 GATGCTCACCTGGGGGTGTGGGG - Intronic
900441893 1:2659861-2659883 GATGCTCACCCGGGGATATGGGG - Intronic
900442258 1:2661748-2661770 GATGCTCACCTGGGGGTGTGGGG - Intronic
900442787 1:2664477-2664499 GATGCTCACCCGGGGATATGGGG - Intronic
900443151 1:2666364-2666386 GATGCTCACCTGGGGGTGTGGGG - Intronic
900443680 1:2669093-2669115 GATGCTCACCCGGGGATATGGGG - Intronic
900444045 1:2670980-2671002 GATGCTCACCTGGGGGTGTGGGG - Intronic
900444682 1:2674271-2674293 GATGCTCACCCGGGGATATGGGG - Intronic
900444948 1:2675636-2675658 GATGCTCACCTGGGGGTGTGGGG - Intronic
900445657 1:2679370-2679392 GATGCTCACCTGGGGGTGTGGGG - Intronic
900447112 1:2686836-2686858 GATGCTCACCTGGGGGTGTGGGG - Intronic
900447211 1:2687318-2687340 GATGCTCACCTGTGGGTTTGGGG - Intronic
900447423 1:2688322-2688344 GATGCTCACCTGGGGGTGTGGGG - Intronic
900447903 1:2690693-2690715 CATGCTCACCCGGGGATGTGGGG - Intronic
900448609 1:2694262-2694284 GATGCTCACCTGGGGGTGTGGGG - Intronic
900448708 1:2694744-2694766 GATGCTCACCTGTGGGTTTGGGG - Intronic
900449062 1:2696512-2696534 GATGCTCACCTGGGGGTGTGGGG - Intronic
900449469 1:2698520-2698542 GATGCTCACCTGGGGGTGTGGGG - Intronic
900450754 1:2748473-2748495 GATGCTCACCCGGGGATGTGGGG - Intronic
900452080 1:2755214-2755236 GATGCTCACCTGGGGGTGTGAGG - Intronic
900452176 1:2755696-2755718 GATGCTCACCTGTGGGTTTGGGG - Intronic
900452529 1:2757463-2757485 GATGCTCACCTGGGGGTGTGGGG - Intronic
900452938 1:2759471-2759493 GATGCTCACCTGGGGGTGTGGGG - Intronic
900454083 1:2765382-2765404 GATGCTCACCTGGGGGTGTGGGG - Intronic
900454135 1:2765628-2765650 AATGCTCACCTGGGGGTGTGGGG - Intronic
900454827 1:2769176-2769198 GATGCTCACCTGGGGGTGTGGGG - Intronic
900454876 1:2769379-2769401 GATGCTCACCTGGGGGTGTGGGG - Intronic
900455530 1:2772644-2772666 GATGCTCACCTGGGGGTGTGGGG - Intronic
900455582 1:2772890-2772912 AATGCTCACCTGGGGGTGTGGGG - Intronic
900456365 1:2776920-2776942 GATGCTCACCTGGGGGTGTGGGG - Intronic
900456414 1:2777123-2777145 GATGCTCACCTGGGGGTGTGGGG - Intronic
901369199 1:8781915-8781937 CAGGTTCACAGAGGGATTTGGGG + Intronic
901441950 1:9283368-9283390 CAGGCCCAAGTGGGGATCTGGGG - Intergenic
901457290 1:9370429-9370451 CAAGGTCACCTAGGGAGTTGAGG - Intergenic
902790513 1:18764694-18764716 CAGGGTCAGGTGGGGATTTCTGG + Intergenic
903487602 1:23702269-23702291 CAGCCTTCCTTGGGGATTTGGGG - Intergenic
903818579 1:26083347-26083369 CAGGTTCACCTGGGGTTTGGAGG - Intergenic
904446288 1:30575447-30575469 CAGTCTCCCCTGGAGATATGAGG - Intergenic
905804027 1:40862865-40862887 CAGGCTCTCCTGGGGGTTATGGG - Intergenic
907156682 1:52341382-52341404 GAGGCTCACCTGGGAATGAGAGG + Intronic
910530099 1:88226042-88226064 CTGGCTCTCGTGGGAATTTGGGG + Intergenic
910684655 1:89904002-89904024 CAGGCTAAACTGGGGATTCCAGG - Intronic
912948932 1:114107194-114107216 GAGGCTTGCCTGGGGATATGAGG + Intronic
914916205 1:151820749-151820771 CAAGATTACCTGGGGATCTGAGG + Intronic
919865698 1:201781296-201781318 CAGGCTCACCTGCGACTTTGAGG - Exonic
919920449 1:202163863-202163885 CAGGCTGGCCTAGGGTTTTGGGG - Intergenic
920342499 1:205284392-205284414 CAGGCTCCCCTGGGGCCCTGAGG + Intergenic
922573376 1:226646592-226646614 CGGGCTCACCTGGGGCCCTGCGG + Intronic
922671629 1:227512481-227512503 CAGGCTGACCTGGAGAGATGGGG - Intergenic
924245502 1:242079792-242079814 CAGCCTCTCCTTGGGATTTCTGG + Intergenic
1064635891 10:17366680-17366702 CTGGGTCACCTGTAGATTTGGGG - Intronic
1064848647 10:19685130-19685152 CAATCTCACCTGGGCATTTATGG - Intronic
1067942573 10:50669005-50669027 CAGACTCACCCGAGGATTTGTGG - Intergenic
1068991685 10:63157361-63157383 CAGGTTGAACCGGGGATTTGTGG + Intergenic
1069412915 10:68171364-68171386 GAGAATCACCTGGGGCTTTGTGG + Intronic
1069728506 10:70596411-70596433 CTGTCCCACCTGGGGATTTAGGG + Intergenic
1069861037 10:71471984-71472006 CAGGCACACCTGTAGATGTGGGG - Intronic
1070863815 10:79693963-79693985 CAGACTCACCCGAGGATTTGTGG - Intergenic
1072715254 10:97747852-97747874 CAGACTCACTTGGGGAGTTCTGG - Intronic
1073005671 10:100322134-100322156 GAGGCTCACCTGAGAGTTTGAGG + Intronic
1073095750 10:100978723-100978745 CAGGCTCACCTGGGGATTTGGGG - Intronic
1073121725 10:101125974-101125996 CAGGATCACCTGGTGACTTAGGG - Intronic
1073250698 10:102119050-102119072 CAGCTTCCCTTGGGGATTTGTGG + Intronic
1074975937 10:118581714-118581736 CAGGCTCTACAGAGGATTTGAGG + Intergenic
1075343016 10:121662192-121662214 CAGGCTCAGCAGAGGAATTGGGG + Intergenic
1075665323 10:124225717-124225739 CGGGGTCACATGGGAATTTGGGG - Intergenic
1076695706 10:132246331-132246353 CAGGCAGGCCTGGGGTTTTGGGG + Intronic
1076931197 10:133533051-133533073 CAAGCTGGCCTGGGGCTTTGGGG + Intronic
1077167234 11:1149168-1149190 CAGCCTCCCCTGGGCATTTTGGG + Intergenic
1077400175 11:2351741-2351763 CAGGACCACCTGGAGACTTGGGG - Intergenic
1078762821 11:14265111-14265133 CAGCCTCACCTGCGTATCTGGGG + Intronic
1078977205 11:16492437-16492459 CAAGCTCACCTTGGGAGATGGGG + Intronic
1079101871 11:17547103-17547125 CAGCCTCCCCTGGGGAGGTGTGG + Intergenic
1079978044 11:27116973-27116995 GAGATTCTCCTGGGGATTTGTGG - Intronic
1083294447 11:61707599-61707621 CGGGCTTACCTGGTCATTTGTGG + Intronic
1085498393 11:76994013-76994035 CAAGTTCACCCAGGGATTTGTGG + Intronic
1085529129 11:77181366-77181388 CAGGCGCTCCTGGGCAATTGGGG - Exonic
1087870174 11:103284107-103284129 CAGAATCACCTGGGGAATGGTGG - Intronic
1089158627 11:116421287-116421309 CAGGCTCACCTGTGGCTCAGGGG - Intergenic
1089500878 11:118930472-118930494 TACGCTCACATGGGGATTCGCGG + Intronic
1090077800 11:123590487-123590509 CAGGCTCAGCTGGGGGTTACTGG + Intronic
1090847576 11:130543874-130543896 CAGCCTCACCTGGGAATTTGGGG - Intergenic
1090862527 11:130666664-130666686 CAGGCACAACTGGGCATCTGTGG + Intergenic
1092162383 12:6322981-6323003 CTGGCTATCCTGGGGAGTTGGGG - Intronic
1092262484 12:6959997-6960019 GAGGGGCACCTGGGGGTTTGGGG + Intronic
1093280908 12:17195263-17195285 CAGGGTCCCCTGAGGGTTTGGGG + Intergenic
1094465936 12:30754441-30754463 CAGGCTCCCCCGGAGACTTGAGG - Exonic
1096243204 12:49970411-49970433 CAGTCTCACCTGTGGCTTTCAGG - Intronic
1097050084 12:56217616-56217638 CTGGTCCATCTGGGGATTTGGGG - Intronic
1100785264 12:98071668-98071690 CAGGCACAGGTGGGGGTTTGGGG + Intergenic
1108959833 13:56212530-56212552 CAGGCTCAGATGGCAATTTGTGG + Intergenic
1109902185 13:68788505-68788527 CAGGATCACTTGGGAAGTTGAGG + Intergenic
1110161623 13:72385288-72385310 AAGGCTTCCCTGAGGATTTGAGG - Intergenic
1111496663 13:89059779-89059801 AATGCTGACCTTGGGATTTGAGG + Intergenic
1111534959 13:89591579-89591601 GTGGCTCACTTGGGGACTTGAGG + Intergenic
1111826802 13:93277555-93277577 CAAGCTCAGATGGGGATTTGAGG - Intronic
1115203835 14:30880203-30880225 CTGCCTCACCTGTGGGTTTGGGG + Intronic
1116502620 14:45638845-45638867 TAGGCACAACTGGGGATTTATGG - Intergenic
1118902354 14:69997197-69997219 CAGGCTTACCTGGGCATGTCAGG - Intronic
1119207696 14:72806958-72806980 CAGACTCTCCTGGGGAATGGAGG - Intronic
1121717799 14:96088697-96088719 CAGGCCCTCCTAGGGATGTGGGG - Exonic
1122650997 14:103227026-103227048 CAGTCTCACCTGGGGCTTGGGGG + Intergenic
1124415719 15:29471849-29471871 CATGCACACGTGGAGATTTGGGG + Intronic
1126731858 15:51691711-51691733 CAGTCACACCTGGGAATTTTTGG - Intronic
1126762006 15:51977878-51977900 AAGGCTCAGCTGGGCACTTGTGG - Intronic
1126962398 15:54011805-54011827 CAGGCTCTGCAGGGGATTTGGGG - Intergenic
1128473270 15:67974704-67974726 CAGGCAGCACTGGGGATTTGTGG - Intergenic
1128731899 15:70026932-70026954 CAGTCACACCTGGGGACTTGTGG + Intergenic
1131258665 15:90877327-90877349 CTGGCCCACCTGGGGCTCTGAGG + Intronic
1132029842 15:98430519-98430541 CAGGCTCACTTGGGCAGTGGTGG + Intergenic
1133003686 16:2865337-2865359 AAGGGGCACCTGGGGACTTGGGG - Intergenic
1133771594 16:8869701-8869723 CAGGGTCAGCTTGGTATTTGAGG + Intergenic
1135918875 16:26630601-26630623 CAGGCTCAGCTGGGGGTCTCGGG + Intergenic
1136086937 16:27891992-27892014 CGGACTCACCTGGGCACTTGTGG + Intronic
1136157079 16:28390282-28390304 CAGGCTCACCTTGGGAGTGAGGG + Exonic
1136206007 16:28724999-28725021 CAGGCTCACCTTGGGAGTGAGGG - Exonic
1138209044 16:55147505-55147527 CAGACTCATCTGGGAATCTGGGG + Intergenic
1139303991 16:65967846-65967868 TAGGCTGACCTTGGTATTTGAGG + Intergenic
1140279371 16:73541050-73541072 CAGGCTGGCCTGGTGCTTTGGGG - Intergenic
1140689699 16:77469857-77469879 CAGGGTCCCCAGGGGCTTTGGGG - Intergenic
1140847521 16:78904581-78904603 CAGGCTGACCTGGGGAAGGGAGG - Intronic
1141109983 16:81264401-81264423 CAACCTCACATGGGGATTTGAGG - Intronic
1141821902 16:86452139-86452161 CAGGCTCCCTTGTGGATTTAAGG + Intergenic
1141849043 16:86631456-86631478 CAGTCTTCCCTGGTGATTTGGGG + Intergenic
1142232227 16:88905373-88905395 CAGCCTCTCCTGGGGAAGTGAGG - Intronic
1143380011 17:6490188-6490210 CGGGCTCACCTGGGGAATGGGGG - Intronic
1143594529 17:7906436-7906458 CTGGAGCACCTGGGGATTTGGGG + Intronic
1144063849 17:11606982-11607004 CATGTTCACCTATGGATTTGGGG + Intronic
1145266617 17:21382799-21382821 GGGGCTCACCTGGGGAGTGGGGG + Intronic
1146504551 17:33393730-33393752 CAGGCACACCTGGGGGTTCATGG + Intronic
1148701129 17:49587690-49587712 CAGGAGGACCTGGGAATTTGGGG - Intergenic
1149661209 17:58334922-58334944 GAGGGTCACCTGGGAATCTGGGG + Intergenic
1150578112 17:66447770-66447792 CAGTTTCACCTGGGGCTATGTGG + Intronic
1150998744 17:70349678-70349700 CAGCATCACCTGGGAACTTGAGG - Intergenic
1151255097 17:72870644-72870666 CACGCTCTCCTGCAGATTTGTGG + Intronic
1151898986 17:76999223-76999245 GAAGCTCACCTGAGGCTTTGGGG - Intergenic
1151990785 17:77572643-77572665 CAGCGTCACCTGGGGATTTGTGG + Intergenic
1152907639 17:82977574-82977596 CAGGCTCTCCGGGGGGTCTGGGG + Intronic
1155024661 18:21930395-21930417 CAGGGTCATCTGTGGAGTTGCGG - Intergenic
1155997977 18:32352429-32352451 CAGTCACTCCTGGGGATTTGTGG + Intronic
1156497820 18:37537597-37537619 CAGGCTCACATGTGGAGTTGGGG - Intronic
1157480468 18:48050478-48050500 CAGGCTCAGCTGGGGACTGCGGG - Intronic
1160539548 18:79612952-79612974 CAGGCACACCTGGGTACATGCGG + Intergenic
1160552892 18:79706329-79706351 CTGGAACACATGGGGATTTGGGG - Intronic
1161453142 19:4357668-4357690 CAGGCTCCACTGGAGAGTTGGGG + Intronic
1161687595 19:5711086-5711108 CAGGCCCACCTGGGTTCTTGAGG - Intronic
1163080414 19:14936154-14936176 CAGCCTCACCAGGGCATTTTTGG + Intergenic
1163571830 19:18086839-18086861 GAGGCTCCCCTGGGGCTGTGGGG - Exonic
1165064894 19:33223424-33223446 CAGGCTCCCCAGGGTATTGGTGG + Intronic
1166271891 19:41719594-41719616 CTGGCCAACCTGGGGACTTGTGG - Intronic
1167196073 19:48029610-48029632 CTGGCTGAACTGGGGATTTGGGG + Intergenic
1167425289 19:49427060-49427082 CATGCTTTTCTGGGGATTTGGGG - Exonic
925818152 2:7773629-7773651 CAGGCCAACCTTGGGAATTGTGG - Intergenic
928283441 2:29968586-29968608 CAGCCTCACGTTGGGATCTGGGG + Intergenic
931164517 2:59732616-59732638 CTGGCTCACAAGGGGCTTTGTGG - Intergenic
932689634 2:73901262-73901284 CTGGAGCACCTTGGGATTTGCGG - Exonic
932770526 2:74498477-74498499 CAGGCCCAGGTGGGGATATGGGG + Intronic
932905572 2:75746458-75746480 CAGGCTCAGCTGGGCAGATGTGG - Intergenic
933719693 2:85390041-85390063 CTGGCTCCCCTGGGGAAATGGGG + Intronic
934043088 2:88146348-88146370 CAAGCTCCCCTGGTGTTTTGGGG + Intergenic
934117902 2:88813259-88813281 CAGGCTGACATGGGGCTTTCTGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934545157 2:95207954-95207976 CGGTCTCACTTGGGGTTTTGAGG + Intronic
935600235 2:104915014-104915036 CAGACACAGCTGGGGATCTGAGG + Intergenic
936152286 2:110028474-110028496 TAGGCTCAGCTGGGGACTTGGGG - Intergenic
936192391 2:110342938-110342960 TAGGCTCAGCTGGGGACTTGGGG + Intergenic
938381284 2:130837688-130837710 CTGGCTCACCTGGGGAGGTCGGG - Intronic
938381636 2:130839452-130839474 AAGGCACACCTGGGGCCTTGGGG - Intronic
942482891 2:176407755-176407777 CCTGCTCATTTGGGGATTTGGGG + Intergenic
945038853 2:205727877-205727899 CAGGTCCACCTGGGGAATAGAGG - Exonic
946160886 2:217835264-217835286 CAGGCTGACGAGGGGATGTGGGG - Intronic
946365800 2:219248301-219248323 CTCACTCACCTGGGGCTTTGTGG - Exonic
947155963 2:227163889-227163911 CGGGCCCAGCTGGGGAGTTGTGG - Intronic
947169104 2:227293243-227293265 CTGGCCCACCTGGACATTTGGGG + Exonic
1168836298 20:879942-879964 CAGGCTCACCTGTTGCTCTGTGG - Intronic
1168977094 20:1974894-1974916 GAGTCTCACCTGGGGATGTGAGG - Intergenic
1171382433 20:24743750-24743772 CAGGATCACCTGGGAGCTTGTGG - Intergenic
1172384658 20:34525429-34525451 GAGGCACACCCAGGGATTTGGGG + Intronic
1174775536 20:53339930-53339952 CAGACACACATTGGGATTTGGGG - Intronic
1174851820 20:54002922-54002944 CCTGCTCAACTGGGCATTTGAGG + Intronic
1175134311 20:56811379-56811401 CCGGCTCACCTCTGAATTTGGGG + Intergenic
1175249272 20:57598992-57599014 CAGGCTCACCCCTGAATTTGGGG - Intergenic
1175867040 20:62184390-62184412 CATGCTCACAGGAGGATTTGAGG + Intronic
1175912794 20:62412745-62412767 CAGGCCCACCTGGGGAGAAGGGG + Exonic
1176070530 20:63223970-63223992 CAGGCTCACCTGGAGGTTTCAGG - Intergenic
1178693147 21:34766802-34766824 CAGGGTCACAGGGGCATTTGAGG - Intergenic
1179436245 21:41364023-41364045 CAGGCTCTCTTGAGAATTTGGGG + Intronic
1181022936 22:20112991-20113013 CAGGATCACCTTGGAATCTGAGG + Exonic
1181403902 22:22668394-22668416 CAGGCTCAACTTGGGGTCTGTGG - Intergenic
1181406239 22:22686861-22686883 CAGGCTCAACTTGGGATCTGTGG - Intergenic
1181414189 22:22747501-22747523 CAGGCTCAACTTGGAATCTGTGG - Intronic
1181839421 22:25643488-25643510 CAGTCCCACCTGGGGAATTCTGG + Intronic
1182713390 22:32336322-32336344 CAGATTCACCTGGGCCTTTGTGG + Intergenic
1183531280 22:38354972-38354994 CAGCCTCACCTGCTGATTAGCGG - Intronic
1185211569 22:49573503-49573525 CAGGCTCACCTGGGACATGGAGG + Intronic
950965190 3:17141226-17141248 CATGTTCACCTGCGCATTTGAGG + Intergenic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
955400506 3:58587750-58587772 CAGGCTCACCAGGGGGCTTCAGG + Intronic
956629273 3:71298767-71298789 AAGTCTCACCTGGGGCTTGGGGG - Intronic
961148723 3:124617744-124617766 CAGTATCATCTGGGGACTTGTGG - Intronic
962003400 3:131324122-131324144 CAGGGACAGCTGGGGATTTATGG + Intronic
963931141 3:151005472-151005494 CAGCCTCAGCTGGGTCTTTGGGG + Intergenic
965087213 3:164114026-164114048 CAGACTGAAGTGGGGATTTGTGG + Intergenic
965757191 3:172039550-172039572 CGGGACCACATGGGGATTTGGGG - Intergenic
967555459 3:190851576-190851598 CAGGCTCAGCTGAGGATATAAGG - Intergenic
969265468 4:6061583-6061605 CAGCATCATCTGGGTATTTGGGG + Intronic
969442462 4:7225591-7225613 CAGGCCCAGCTGGGGGTTGGGGG + Intronic
969576392 4:8038504-8038526 CTGGCACACCTGGGGACATGGGG - Intronic
969687148 4:8682066-8682088 CAGGCTCATGTGGGGAGTGGAGG - Intergenic
970491566 4:16580434-16580456 CAGTCTCATCTGGGGACTTCAGG - Intronic
981607928 4:146559653-146559675 CAGCCACACATGGGGATTTTGGG + Intergenic
983512377 4:168622439-168622461 CAGGACAACCTGGGGATTTCTGG + Intronic
988734459 5:34007141-34007163 AAGGCTCATTTTGGGATTTGTGG + Intronic
990988540 5:61662540-61662562 CATGCTCTGCTTGGGATTTGTGG + Intronic
991565810 5:68003171-68003193 CAGGCCCACCTAGGGTTTGGTGG + Intergenic
992041288 5:72836007-72836029 CAGGGTGACCTGGAGACTTGGGG - Intronic
999075637 5:148792998-148793020 CAGGGTGAGCTGGGGATTTCAGG - Intergenic
999090154 5:148929008-148929030 CAGGCTGCCCTGGGGATGAGGGG - Intronic
1005468893 6:26142500-26142522 GAGGCCCACATAGGGATTTGAGG - Intergenic
1007067162 6:39002193-39002215 CAGGCTTACCTGGTGTTTCGTGG + Intronic
1007336382 6:41157951-41157973 CAGGCTCTACTGGGGATTTTGGG + Intergenic
1017449158 6:154537595-154537617 CAGGCTCAGCTGGGGTTTTATGG - Intergenic
1018889757 6:167975383-167975405 CAGCATCACCTGGGGGTTGGCGG + Intergenic
1019742360 7:2681158-2681180 CAGGCTGACTTGGGGCTTTCGGG - Intronic
1021387826 7:20053503-20053525 CAGTCTCCCCTGGGAATTCGGGG - Intergenic
1021491824 7:21227262-21227284 CTGTCTCTCCTGGGGATTTGAGG - Intergenic
1022885999 7:34644537-34644559 CAGGCACAGCTGGGCAATTGCGG - Intergenic
1027125521 7:75554119-75554141 CAGGCTCAGGTGGGGCTCTGAGG + Exonic
1027637863 7:80698359-80698381 CATGATCACCTGGGAGTTTGTGG - Intergenic
1030862933 7:114658973-114658995 CAGGCTCACCTCTGCATCTGTGG - Intronic
1031878134 7:127164834-127164856 CAAGGTCACCTAGGGATTGGTGG - Intronic
1035056419 7:156039511-156039533 CAGGACCACCTGGGGAAGTGGGG - Intergenic
1035225184 7:157428742-157428764 CAGGCCCACGTTGGGACTTGGGG - Intergenic
1035331064 7:158097856-158097878 CAGACTCTCCTGCGGTTTTGTGG - Intronic
1035368364 7:158362853-158362875 CAGTCCCATCTGGGGCTTTGGGG - Intronic
1036047175 8:5156621-5156643 AAGGGTCAACTGGGTATTTGTGG + Intergenic
1037667769 8:20985179-20985201 CAAGCCCACTTGGGAATTTGGGG + Intergenic
1040296665 8:46152438-46152460 CAGGCTTGCCTGTGGCTTTGAGG + Intergenic
1044596182 8:93961059-93961081 CAGGCTCCTCCAGGGATTTGGGG + Intergenic
1049500859 8:142964585-142964607 CAGGCACACCTGGGGGTGGGGGG + Intergenic
1050087152 9:1978001-1978023 CAGCTTCACCTGGGAGTTTGTGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056958468 9:91101450-91101472 CAGGCTTCCCTGGGGCTCTGGGG - Intergenic
1059248987 9:112871363-112871385 CAGGCTCCCCTGGGCCTCTGAGG + Exonic
1060976451 9:127767941-127767963 CTGGGTCCCCTGGGGGTTTGGGG + Intronic
1060994964 9:127870749-127870771 CAGCCTCATCTGGGGATAGGAGG - Intronic
1062131715 9:134898460-134898482 TATGCTCAGCTGGAGATTTGGGG + Intergenic
1062599231 9:137312513-137312535 CAGGCTGTCCTGGGGATGTTGGG + Intronic
1192186246 X:68948582-68948604 GAGGCTCAGCTGGGGTGTTGAGG - Intergenic
1192839961 X:74844537-74844559 GAGGCTCGCCAGGGGAGTTGAGG - Intronic
1195728489 X:107941219-107941241 CAGGCTCCCTTAAGGATTTGGGG + Intergenic
1195740706 X:108062067-108062089 CAGGCTAACATGGAAATTTGGGG + Intronic
1198636736 X:138710427-138710449 CAGGCTCTCCTGGGGACGGGAGG + Intronic
1202069266 Y:20973508-20973530 CTGGGTCACCTGGGGAGTTTTGG - Intergenic