ID: 1073097103

View in Genome Browser
Species Human (GRCh38)
Location 10:100986686-100986708
Sequence CAGGCTTTGGACTGTTACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 234}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073097103_1073097110 -6 Left 1073097103 10:100986686-100986708 CCGGAGTAACAGTCCAAAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 234
Right 1073097110 10:100986703-100986725 AGCCTGGGGCTGCAGTTGGTGGG 0: 1
1: 0
2: 0
3: 31
4: 321
1073097103_1073097111 -5 Left 1073097103 10:100986686-100986708 CCGGAGTAACAGTCCAAAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 234
Right 1073097111 10:100986704-100986726 GCCTGGGGCTGCAGTTGGTGGGG 0: 1
1: 0
2: 3
3: 51
4: 496
1073097103_1073097114 22 Left 1073097103 10:100986686-100986708 CCGGAGTAACAGTCCAAAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 234
Right 1073097114 10:100986731-100986753 TCTTCACTGTGCTTGCACCTGGG 0: 1
1: 0
2: 1
3: 16
4: 195
1073097103_1073097109 -7 Left 1073097103 10:100986686-100986708 CCGGAGTAACAGTCCAAAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 234
Right 1073097109 10:100986702-100986724 AAGCCTGGGGCTGCAGTTGGTGG 0: 1
1: 1
2: 2
3: 36
4: 418
1073097103_1073097116 27 Left 1073097103 10:100986686-100986708 CCGGAGTAACAGTCCAAAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 234
Right 1073097116 10:100986736-100986758 ACTGTGCTTGCACCTGGGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 261
1073097103_1073097115 26 Left 1073097103 10:100986686-100986708 CCGGAGTAACAGTCCAAAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 234
Right 1073097115 10:100986735-100986757 CACTGTGCTTGCACCTGGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 274
1073097103_1073097113 21 Left 1073097103 10:100986686-100986708 CCGGAGTAACAGTCCAAAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 234
Right 1073097113 10:100986730-100986752 CTCTTCACTGTGCTTGCACCTGG 0: 1
1: 0
2: 2
3: 15
4: 195
1073097103_1073097117 28 Left 1073097103 10:100986686-100986708 CCGGAGTAACAGTCCAAAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 234
Right 1073097117 10:100986737-100986759 CTGTGCTTGCACCTGGGCTGGGG 0: 1
1: 0
2: 3
3: 37
4: 372
1073097103_1073097108 -10 Left 1073097103 10:100986686-100986708 CCGGAGTAACAGTCCAAAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 234
Right 1073097108 10:100986699-100986721 CCAAAGCCTGGGGCTGCAGTTGG 0: 1
1: 0
2: 3
3: 43
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073097103 Original CRISPR CAGGCTTTGGACTGTTACTC CGG (reversed) Intronic
903257024 1:22109234-22109256 CAGGTCTATGACTGTTACTCTGG - Intergenic
904455985 1:30648384-30648406 CAGCCTTTGATCTGCTACTCTGG - Intergenic
906910591 1:49944392-49944414 CAGGCTTTGGGCTGTTACTGGGG - Intronic
906945054 1:50288432-50288454 AAGGCTTTGGACTCTGACTTAGG - Intergenic
907110263 1:51920711-51920733 CAGGTTTTGGACTTTTTCGCAGG + Intronic
907837187 1:58121221-58121243 CATGTTTTGGAAGGTTACTCTGG - Intronic
908803689 1:67907699-67907721 CAGGCTTCGGGCTGGTACTGGGG + Intergenic
908861978 1:68499420-68499442 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
909448896 1:75776973-75776995 CAGGGTTTGCTCTGTCACTCAGG - Intronic
909863848 1:80640390-80640412 CAGGCTGTGGACGTTTACACTGG - Intergenic
911317935 1:96376983-96377005 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
912626803 1:111212144-111212166 CAGGGTTTGGTCTGAGACTCTGG + Intronic
913972982 1:143430189-143430211 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
914067366 1:144255796-144255818 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
914111787 1:144710558-144710580 CTGGCTTTGGGCTGGTACTAGGG - Intergenic
917501252 1:175587311-175587333 TAGGCTTTGGACTGTGATCCAGG + Intronic
919277962 1:195445348-195445370 CAGGCTCTGGGCTGGTACTAGGG - Intergenic
919397575 1:197069816-197069838 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
919928121 1:202203223-202203245 CTGCCTTTGGCCTGTTTCTCAGG - Intronic
920883282 1:209899961-209899983 CAGGTTTTGGACTCAGACTCAGG - Intergenic
921762820 1:218936918-218936940 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
921842969 1:219847694-219847716 CAGGCTTTGGGCTGGTGCTGGGG - Intronic
923691857 1:236202046-236202068 CGGGCTTTGGACTGGTGCTGGGG + Intronic
924894279 1:248318447-248318469 CAGGCTCTGGGCTGGTACTAGGG - Intergenic
1064908077 10:20369815-20369837 CAGGCTCTGGGCTGTTACTGGGG + Intergenic
1064988967 10:21239183-21239205 CAGACTTGGGACTATTATTCAGG - Intergenic
1069530719 10:69217408-69217430 CAGCCTTTGGAATTTTAATCAGG - Intergenic
1070265694 10:74900569-74900591 CATGCTTTAGACTGTCACCCAGG + Intronic
1072312741 10:94172035-94172057 GAGGCTTTGGATTGATATTCTGG - Intronic
1073097103 10:100986686-100986708 CAGGCTTTGGACTGTTACTCCGG - Intronic
1073583486 10:104687749-104687771 CAGGCTCTGGAGTCTGACTCTGG + Intronic
1073900407 10:108214720-108214742 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1074688222 10:115979377-115979399 CAGGGTTTGCTCTGTTGCTCAGG - Intergenic
1075078237 10:119365838-119365860 CAGGCTGTGAACTGCTACACAGG - Intronic
1076666237 10:132094558-132094580 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1076688948 10:132211065-132211087 CAGGCTTTGCCCTGTCACTGTGG + Intronic
1078165552 11:8880810-8880832 CAGGCTTGGGACAGTTGCTGTGG - Intronic
1079221956 11:18570986-18571008 CAGGATTTGGGCTGCCACTCTGG - Intronic
1080270743 11:30448444-30448466 CAGGCTTCTGATTGTTACACGGG + Intronic
1081091064 11:38867025-38867047 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1081326695 11:41754099-41754121 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1082903960 11:58285771-58285793 CAGGCTCTGGGCTGGTACTGTGG - Intergenic
1083528482 11:63395518-63395540 CAGGCTCTGGGCTGGTACTGGGG + Intronic
1085512802 11:77096832-77096854 CAGGCATTCGACTGGGACTCTGG - Intronic
1087729711 11:101764804-101764826 CGGGTTTTGGTCTGTTACCCAGG - Intronic
1088179537 11:107093072-107093094 CAGACTCTGGACTGGTACTGGGG - Intergenic
1088181467 11:107117387-107117409 CTGCCTTTGAGCTGTTACTCTGG - Intergenic
1088730433 11:112677007-112677029 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1089846759 11:121464838-121464860 CAGGCTGTGGACTGGGTCTCTGG - Intronic
1090673585 11:128969274-128969296 CAGTCTCTGGAGTGTTTCTCTGG + Exonic
1091380865 12:57764-57786 CAGGCTCTGGGCTGTTACTGGGG - Intergenic
1093389662 12:18602714-18602736 CTGGCTTTGGGCTGGTACTGGGG - Intronic
1093914561 12:24786952-24786974 CAAGCTTAGGACTGTAACTTGGG - Intergenic
1094364974 12:29670735-29670757 GAGGTTTTGCAGTGTTACTCAGG - Intronic
1095829466 12:46569276-46569298 TAGGATTGGGAATGTTACTCCGG + Intergenic
1096347945 12:50866822-50866844 CAGGCTCTGGGCTGGTACTGGGG - Intronic
1096386056 12:51196105-51196127 CAGGCTTTGGGCTGGTGCTGGGG + Exonic
1100951331 12:99853425-99853447 CAGGCTCTGGGCTGGTACTGGGG - Intronic
1100970337 12:100063307-100063329 CAGGCTCTGGGCTGGTACTGGGG - Intronic
1101302926 12:103500080-103500102 CAGCCTTTTAACTGTTACTATGG + Intergenic
1102421029 12:112803006-112803028 CAGGCTTTGGACAGCTTCTGGGG - Intronic
1103999646 12:124852365-124852387 CAGGCTTTGGGGTGTTCCCCAGG + Intronic
1105598799 13:21866749-21866771 CAGGCTCTGGGCTGTTACTGGGG + Intergenic
1105693503 13:22865122-22865144 CAGGCCTTGCTCTGTCACTCAGG + Intergenic
1108131957 13:47310931-47310953 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1108250279 13:48560120-48560142 CATTCCTTGGACTATTACTCAGG + Intergenic
1109058250 13:57580647-57580669 CAGGCTGTGGGCTGCTACTGGGG + Intergenic
1109534600 13:63699945-63699967 CAGGCTCTGGGCTGGTACTGAGG + Intergenic
1109796388 13:67319010-67319032 CTGGCTTTAGACAGTTCCTCAGG + Intergenic
1109893952 13:68657400-68657422 CAGGATTTATACTGGTACTCTGG + Intergenic
1111570157 13:90073596-90073618 CAGGTTTTGCTCTGTCACTCAGG - Intergenic
1113862170 13:113494142-113494164 CATCCAATGGACTGTTACTCAGG - Intronic
1114030727 14:18577686-18577708 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
1114680155 14:24477532-24477554 CAGGTCTTGGTTTGTTACTCAGG + Intergenic
1115932744 14:38515608-38515630 CAGTCCTATGACTGTTACTCTGG + Intergenic
1117142232 14:52800784-52800806 CAGGGTTTGCTCTGTTGCTCAGG - Intergenic
1117240769 14:53830046-53830068 CAGGCTCTGGACTGGTGCTGGGG - Intergenic
1117880641 14:60310060-60310082 CTGCCTTTGAACTGCTACTCTGG - Intergenic
1120400272 14:84022596-84022618 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1120519107 14:85505579-85505601 CAGGCTGTGGATTTTTACTTAGG + Intergenic
1121503409 14:94458310-94458332 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1127194528 15:56569234-56569256 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1127227777 15:56951673-56951695 CAGGTTTTGCTCTGTTGCTCAGG + Intronic
1129302672 15:74634912-74634934 AAGGATTTGGGCTTTTACTCTGG - Intronic
1131326780 15:91455818-91455840 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1138669125 16:58598689-58598711 CTGGCTTTGGGCTGGTGCTCAGG - Intronic
1142933206 17:3306175-3306197 CAGGCCTTGCTCTGTTACCCAGG + Intergenic
1149378858 17:56072727-56072749 CAGGCTCTGGCCTGTAACTGAGG + Intergenic
1149731623 17:58952276-58952298 GTGGCCATGGACTGTTACTCTGG + Intronic
1150328891 17:64278686-64278708 CAGGCTTGGGCCTGTCACACAGG - Intergenic
1150675989 17:67245941-67245963 CGGGCTGCGGACTGTGACTCCGG + Intronic
1157979231 18:52361934-52361956 CAGCCCTTGGACAGTTATTCTGG - Intronic
1158097710 18:53793173-53793195 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1158653757 18:59309941-59309963 CAGACTTAGGACTGGAACTCAGG - Intronic
1159787147 18:72727548-72727570 CAGGCTCTGGACTGGTACTGGGG - Intergenic
1161637600 19:5398812-5398834 CAGGCTTTGGACAGTTCCACAGG - Intergenic
1164578344 19:29419053-29419075 CTGGCTTTGAACTGGTATTCTGG - Intergenic
1166035018 19:40161780-40161802 CAGGCCTGGGAATGTTACACTGG - Intergenic
1167254443 19:48418808-48418830 GAGGCTTGGGCCTGTGACTCAGG + Intronic
925317799 2:2938838-2938860 CAGGCTTTGCATTTTTATTCAGG + Intergenic
925723130 2:6847263-6847285 CAGTTTTTGGACTGTGAGTCTGG - Intronic
927363435 2:22264421-22264443 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
928335020 2:30390526-30390548 AAGTCTTTGGGCTTTTACTCAGG + Intergenic
928431158 2:31219352-31219374 CAGGCTTCCGACTGTCACCCAGG + Intronic
928685366 2:33744246-33744268 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
928732941 2:34253755-34253777 CAGTCTTTTCACTGTTACTCAGG + Intergenic
929806079 2:45145881-45145903 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
931031600 2:58181194-58181216 CATGCAATGGACTATTACTCAGG + Intronic
932266199 2:70368945-70368967 CAGGCTTTGGAATGTTGTTCTGG + Intergenic
932270436 2:70404134-70404156 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
934109223 2:88726193-88726215 CAGGCTTTGGTCAGGTACTGGGG + Intronic
934177679 2:89591145-89591167 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
934187076 2:89756641-89756663 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
934287978 2:91665446-91665468 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
934309559 2:91851284-91851306 CTGGCTTTGGGCTGGTACTAGGG - Intergenic
934712538 2:96525434-96525456 CAGACTTAGGTCTGTCACTCAGG - Intergenic
936140909 2:109939287-109939309 CAGGCTCTGGACTGGTCCTGGGG - Intergenic
936164514 2:110107879-110107901 CTGGCTCTGGGCTGGTACTCTGG - Intronic
936177600 2:110237232-110237254 CAGGCTCTGGACTGGTCCTGGGG - Intergenic
936203784 2:110432199-110432221 CAGGCTCTGGACTGGTCCTGGGG + Intronic
937259937 2:120578806-120578828 CATGCTCTGGGCTGTTCCTCTGG - Intergenic
937828885 2:126399002-126399024 CAGGCTCTGGGCTGGTACTGAGG + Intergenic
938175688 2:129126085-129126107 CAGGCTATGCACTGTTGCTCTGG - Intergenic
939240200 2:139548290-139548312 CAGGCTCTGGGCTGGTACTAGGG + Intergenic
939625402 2:144471232-144471254 CAGCTTTTGGAAAGTTACTCTGG - Intronic
940217594 2:151316196-151316218 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
941409698 2:165139111-165139133 CAGGCTTTAGTCTGTTCTTCAGG - Intronic
943449300 2:188028300-188028322 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
944162108 2:196674285-196674307 CATGCTTCAGACTGTTACTATGG + Exonic
945100568 2:206258928-206258950 CAGGCTTTGCCATGTTGCTCAGG - Intergenic
945778014 2:214131600-214131622 CAGACAATGGAATGTTACTCGGG + Intronic
946805387 2:223465883-223465905 GAGGCTGTGGAGTGTGACTCTGG + Intergenic
947235978 2:227941258-227941280 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1170463441 20:16600590-16600612 CAGGTCTTGCTCTGTTACTCAGG + Intergenic
1170655700 20:18286073-18286095 CCTGCTTTTGACTGTAACTCTGG + Intergenic
1171066878 20:22026266-22026288 CAGGCTTTGGACTGGTACTGGGG + Intergenic
1171352888 20:24518289-24518311 CCGGCTCTGGACTGGTACTAGGG + Intronic
1172392199 20:34573556-34573578 CAGGCTGTGGACTATTTCTGTGG + Intronic
1174696050 20:52560298-52560320 CAGTCATGGGACTGTTACTCTGG + Intergenic
1174796614 20:53527819-53527841 CAGTCTGTGGACTGAGACTCAGG - Intergenic
1177140584 21:17353458-17353480 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1178325569 21:31642719-31642741 CAGTCTTTGCCCTGTTGCTCAGG + Intergenic
1180454841 22:15504742-15504764 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
1180536653 22:16398421-16398443 CTGGCTTTGGGCTGGTACTAGGG - Intergenic
1181514499 22:23403118-23403140 CAGGCTCTGCACTGTTTCTTAGG + Intergenic
1181990510 22:26833390-26833412 CAGGGTTTGCTCTGTTACCCAGG + Intergenic
1182118239 22:27770287-27770309 CTGTCTATGGACTGTGACTCTGG - Intronic
951183857 3:19689146-19689168 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
955477483 3:59353111-59353133 CAGGCTGTGGACTGGTACTGGGG + Intergenic
956315180 3:67927455-67927477 CAGGCTTGGGTCTATGACTCAGG + Intergenic
956360049 3:68438165-68438187 CAGGGTTTTGTCTGTTGCTCAGG - Intronic
957015672 3:75061868-75061890 CAGGGTTTCCACTGTTGCTCAGG + Intergenic
957415356 3:79895207-79895229 CTGCCTTTGGGCTGCTACTCTGG + Intergenic
959715673 3:109430754-109430776 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
959746011 3:109777263-109777285 CAGCTTTTGGACTGTTACTGGGG - Intergenic
959875230 3:111374021-111374043 CAGGCTCTGGGCTGGTACTTGGG - Intronic
960516604 3:118608669-118608691 CAGGCTCTGGGCTGATACTGGGG - Intergenic
962401783 3:135066989-135067011 CAGGCTCTGGGCTGTTACTGGGG + Intronic
962504882 3:136036515-136036537 CAGGCTCTGGACTGCTACTGGGG + Intronic
963091103 3:141484926-141484948 CATGCTTTTGACTGGAACTCTGG - Intergenic
963832530 3:150023380-150023402 CAGGCTCTGGGCTGGTACTGAGG - Intronic
964075727 3:152689117-152689139 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
964299420 3:155271441-155271463 CAGGCTCTGGACTGATACTGAGG - Intergenic
964444605 3:156745469-156745491 CAAGCTTTGGACTGGTCCTGAGG + Intergenic
965469003 3:169066648-169066670 CATGCTCTGGGCTGTTACCCAGG + Intergenic
967554437 3:190837751-190837773 CAGGCTTTGGACCTTGACTTTGG - Intergenic
968807403 4:2784278-2784300 CAGACTCTGGACTGGTACTGGGG + Intergenic
968837547 4:2976255-2976277 CAGGCTCTTGTCTGTTGCTCAGG + Intronic
971050343 4:22855094-22855116 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
972899709 4:43668537-43668559 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
973244448 4:47995944-47995966 CAGGCTCTGGGCTGGTACTAGGG + Intronic
973831497 4:54764457-54764479 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
975942888 4:79668770-79668792 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
976556259 4:86453955-86453977 CAGGCTCTGGGCTGGTACTGGGG - Intronic
976887912 4:90008236-90008258 CGGGCTCTGGACTGGTACTGGGG - Intergenic
977315458 4:95442226-95442248 CAGGGTTTGGTCTGTTGCCCAGG + Intronic
977635603 4:99294155-99294177 CTGGCTTTGGACTGGTACTGGGG - Intergenic
978916153 4:114127908-114127930 CAGGCTCTGGTCTGATACTGGGG - Intergenic
987563634 5:19555964-19555986 CAGGCTCTGGGCTGATACTGGGG - Intronic
987922510 5:24301941-24301963 CAGGCTTTGGACTATGACATGGG - Intergenic
990219574 5:53572993-53573015 CAGGTCTTGCTCTGTTACTCAGG + Intronic
991135277 5:63175839-63175861 GAGGCTTTTGGTTGTTACTCAGG + Intergenic
996031870 5:118714463-118714485 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
996080866 5:119256394-119256416 CAGGCTCTGGGCTGCTACTGGGG - Intergenic
997105916 5:131019379-131019401 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
998506087 5:142674040-142674062 CAGGGTGAGGACTGTTCCTCAGG - Intronic
998580029 5:143363071-143363093 CAGGCCTTGAACTCTTACCCAGG - Intronic
1000237613 5:159377057-159377079 CAGGCTTTGGGCTGGTGCTGAGG - Intergenic
1000772145 5:165368095-165368117 CAGACTTGTGACTGTTACTTGGG - Intergenic
1003157593 6:3609442-3609464 CAGGCCCTGGGCTGTTCCTCTGG + Intergenic
1003297417 6:4844127-4844149 CGGGCTCTGGGCTGGTACTCGGG + Intronic
1006310646 6:33256437-33256459 CAGGTTTTGCTCTGTCACTCAGG - Intronic
1008102116 6:47402707-47402729 CAGGCTCTGGAGTGAAACTCTGG + Intergenic
1008305384 6:49892778-49892800 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1008775339 6:55031626-55031648 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1009332445 6:62440838-62440860 CAGGCTCTGGGCTGATACTGGGG + Intergenic
1009392033 6:63155975-63155997 CAGGCTCTGGGCTGGTACTGCGG - Intergenic
1009800181 6:68527485-68527507 CAGGCTCTGGGCTGGTACTCGGG + Intergenic
1011253166 6:85394291-85394313 CAGGCTGTGGATTGTTACCCTGG - Intergenic
1011620349 6:89237030-89237052 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1011965803 6:93156376-93156398 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1012581229 6:100872729-100872751 CAGGCTTTGGGCTGGTACTGGGG - Intronic
1013428799 6:110037925-110037947 CAGGCTTGGGACATTTACCCAGG - Intergenic
1013610810 6:111793549-111793571 CTGCCTTTGCACTGTCACTCTGG + Intronic
1013946379 6:115727882-115727904 CAGGCTCTAGGCTGTTACTGGGG + Intergenic
1014726684 6:124979531-124979553 CAGGCTTTGCACACTTGCTCAGG - Intronic
1015410133 6:132885040-132885062 CAGGGTTGGCTCTGTTACTCAGG - Intergenic
1015663245 6:135600039-135600061 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1016115062 6:140270827-140270849 GAGGCTTTTGTCTGTTGCTCAGG + Intergenic
1016910067 6:149190088-149190110 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1017093960 6:150787653-150787675 CTGGCTCTGGACTGTTCCACAGG + Intronic
1018211890 6:161490190-161490212 AAGGCTTTGAACTCTTACCCAGG + Intronic
1021816383 7:24451294-24451316 CAGGCTTTGGTATGTTCTTCTGG + Intergenic
1022480654 7:30741107-30741129 CCGGCTTTGGAAGGTTTCTCTGG + Intronic
1024455829 7:49605411-49605433 CAGGCTCTGGGCTGCTACTGGGG - Intergenic
1025794754 7:64729264-64729286 CAGCCTTTGGGCTGGTACACTGG + Intergenic
1025818807 7:64944778-64944800 CAGGCTTTGCCATGTTAGTCAGG + Intergenic
1028822638 7:95230005-95230027 CAGGCTCTGCACTGGTACTTGGG - Intronic
1029526161 7:101095346-101095368 CAGGTTTTGCTCTGTCACTCAGG - Intergenic
1031675858 7:124610945-124610967 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1032931587 7:136678456-136678478 CAGGCTTTGGACTGATAATGGGG - Intergenic
1033306978 7:140231917-140231939 CAGGTTTGGGACTGGAACTCAGG + Intergenic
1036401872 8:8416082-8416104 TAGGGTTTGTTCTGTTACTCAGG + Intergenic
1037355968 8:18019800-18019822 CAGGCCCTGGACTGGTACTGGGG + Intronic
1038505690 8:28082878-28082900 GAGGCTTCGGTCTGTTACCCAGG - Intronic
1040580687 8:48696326-48696348 CAGACTCTGGGCTGTGACTCAGG + Intergenic
1042126591 8:65543638-65543660 CAGGTTTTGCTCTGTCACTCAGG - Intergenic
1042239981 8:66654134-66654156 TAAGCTTTGGACTGATACACAGG - Intronic
1043121620 8:76332312-76332334 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1045671113 8:104553971-104553993 CAGGCTCTGGCCTGGTACTGGGG - Intronic
1046079936 8:109359824-109359846 CAGGCCGTGGACTGTTACCGTGG + Intergenic
1047937437 8:129796690-129796712 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1050321687 9:4459005-4459027 TAGGATTTGGGCTTTTACTCTGG + Intergenic
1050349258 9:4724202-4724224 CAGGCTTTTGACTACTGCTCTGG + Intronic
1051881236 9:21841619-21841641 CAGGCTCTGGGCTGTTGCTGGGG - Intronic
1052040918 9:23738120-23738142 CAGGCTGTGCACTGCAACTCTGG + Intronic
1056696279 9:88856743-88856765 CAGGCTCTGGATTGGTACTGAGG - Intergenic
1058784489 9:108374044-108374066 CAGGCTCTGGGCTGGTACTAGGG + Intergenic
1060330479 9:122664296-122664318 CAGGCTCTGGAAGGCTACTCAGG + Intergenic
1062005450 9:134236460-134236482 CAGGCTTTGTGCTGCCACTCTGG + Intergenic
1191138677 X:57093221-57093243 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1191954189 X:66625855-66625877 CCGGCTTTGGGCTGGTACTGGGG - Intronic
1192688623 X:73334731-73334753 CAGGCTTTGAGCTGATACTGAGG + Intergenic
1194101343 X:89708684-89708706 AAGGTTTTGCTCTGTTACTCAGG - Intergenic
1194299022 X:92162633-92162655 CAGGCTTTGGGTTGGTACTGGGG + Intronic
1194577660 X:95633695-95633717 TAGGCTTTTCACTGTTTCTCTGG - Intergenic
1197363638 X:125536847-125536869 CAGTCTTTGGGCTGGTACTGGGG - Intergenic
1198030405 X:132748800-132748822 AGGGCTTTGCAGTGTTACTCAGG + Intronic
1198521087 X:137453232-137453254 CAATTTTTGGACTGTTACACTGG + Intergenic
1198604480 X:138322050-138322072 CTGGCTCTGGACTGGTACTGGGG + Intergenic
1199121649 X:144061310-144061332 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1199206006 X:145148959-145148981 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1200454294 Y:3369774-3369796 AAGGTTTTGCTCTGTTACTCAGG - Intergenic
1200616625 Y:5387467-5387489 CAGGCTTTGGGTTGGTACTGGGG + Intronic
1200934363 Y:8725297-8725319 CCGGCTTTTGACTGTCATTCTGG - Intergenic