ID: 1073097286

View in Genome Browser
Species Human (GRCh38)
Location 10:100987547-100987569
Sequence CATGCTACTCGCCTTGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073097286_1073097293 22 Left 1073097286 10:100987547-100987569 CCGAGGTCAAGGCGAGTAGCATG 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1073097293 10:100987592-100987614 CGAAGTGGGAGAGAGAAAAGTGG 0: 1
1: 1
2: 4
3: 70
4: 768
1073097286_1073097291 8 Left 1073097286 10:100987547-100987569 CCGAGGTCAAGGCGAGTAGCATG 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1073097291 10:100987578-100987600 ACTCACGTTGCCGGCGAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 26
1073097286_1073097290 7 Left 1073097286 10:100987547-100987569 CCGAGGTCAAGGCGAGTAGCATG 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1073097290 10:100987577-100987599 GACTCACGTTGCCGGCGAAGTGG 0: 1
1: 0
2: 1
3: 2
4: 21
1073097286_1073097289 -1 Left 1073097286 10:100987547-100987569 CCGAGGTCAAGGCGAGTAGCATG 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1073097289 10:100987569-100987591 GTGCGGGAGACTCACGTTGCCGG 0: 1
1: 0
2: 0
3: 5
4: 54
1073097286_1073097294 30 Left 1073097286 10:100987547-100987569 CCGAGGTCAAGGCGAGTAGCATG 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1073097294 10:100987600-100987622 GAGAGAGAAAAGTGGTAACCTGG 0: 1
1: 0
2: 4
3: 35
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073097286 Original CRISPR CATGCTACTCGCCTTGACCT CGG (reversed) Intronic
901276988 1:7999582-7999604 CATCCTCCTTGCCTTGACCTTGG + Intergenic
901672447 1:10863742-10863764 TCTGCTACTACCCTTGACCTTGG + Intergenic
902634122 1:17724067-17724089 CAGCCCACTGGCCTTGACCTTGG + Intergenic
907421975 1:54353707-54353729 AATGCCACTCCCCTTGCCCTGGG - Intronic
914519362 1:148401852-148401874 CATGCTAATCGTATGGACCTTGG + Intergenic
916986075 1:170192299-170192321 CATGCTTCTCCCATTGATCTTGG - Intergenic
1067472488 10:46547100-46547122 CATGCCATTCACCTTGACCCAGG + Intergenic
1069081007 10:64088131-64088153 CATGCAACTCTCCTATACCTAGG + Intergenic
1069473744 10:68715253-68715275 CAGGCTCCTCACCTTGACCTAGG - Intergenic
1069855096 10:71435828-71435850 CATGCTGCTCACCATGGCCTGGG + Intronic
1070916748 10:80159955-80159977 CTTGCTGCTCACCTCGACCTAGG + Intronic
1073097286 10:100987547-100987569 CATGCTACTCGCCTTGACCTCGG - Intronic
1075676314 10:124298048-124298070 CATGCCACTGCCCTTCACCTGGG + Intergenic
1080896661 11:36453880-36453902 CAAGCTCCTCCCCTTGGCCTGGG - Intronic
1082170081 11:48993184-48993206 CAGGAGACTCGCTTTGACCTTGG - Intergenic
1083727148 11:64634543-64634565 CCTGCTACCCACCTTGACCTTGG - Intronic
1085736122 11:79040698-79040720 CATGTGACTTGCCTTGAGCTTGG - Intronic
1089098274 11:115937939-115937961 CATGCTCCTCTCCTTAATCTGGG + Intergenic
1090090915 11:123696953-123696975 CATGCCACCCACCTTGATCTTGG + Intergenic
1090251456 11:125254685-125254707 CATGTTACTCACCTGCACCTGGG - Intronic
1090920216 11:131200353-131200375 CCTCCTACTCACCTGGACCTTGG - Intergenic
1102266226 12:111488091-111488113 CATGCTTCTCTCCTTGACAGTGG + Intronic
1107735940 13:43398712-43398734 CATGCTCCTCGTCTTCACGTTGG - Intronic
1121951543 14:98175174-98175196 CCTGCTAATTGCCCTGACCTAGG - Intergenic
1124346044 15:28922278-28922300 CAGGCTGCTTGCCTTGACCCAGG + Intronic
1125279418 15:38027708-38027730 CCTGCTACTGCCCTTGACCATGG - Intergenic
1133221613 16:4321327-4321349 CCTGCTTCTAGCCTTGACCTTGG + Intronic
1140260406 16:73373345-73373367 CATTCTACCCCCATTGACCTAGG + Intergenic
1151204150 17:72493127-72493149 TTTGCCACTCGGCTTGACCTGGG + Intergenic
1157258203 18:46156967-46156989 CTTGCTGCCCTCCTTGACCTTGG + Intergenic
1157924536 18:51748911-51748933 CATCATACTCCCCATGACCTAGG - Intergenic
1159276036 18:66222692-66222714 CATGCTGCTGGATTTGACCTAGG + Intergenic
1160316605 18:77853843-77853865 TATGCTAATCGCCTCCACCTAGG - Intergenic
1161341910 19:3747685-3747707 CAGGCTCCTCGCCTTGATTTGGG + Intronic
1162462213 19:10819901-10819923 CATGCTACACGCTCTGGCCTGGG + Intronic
1167935354 19:52901860-52901882 CAGGCTACTGGCCTTGGCCAGGG + Intergenic
928070768 2:28213181-28213203 CATGCTACTGGACTCCACCTGGG + Intronic
932335823 2:70930894-70930916 CCTGCTCCTCGCCTGGAGCTGGG - Intronic
941928735 2:170920685-170920707 AATGGTACTGGCTTTGACCTGGG - Intergenic
946015322 2:216599575-216599597 CAGGATAATCGCCTGGACCTGGG - Intergenic
946721713 2:222615802-222615824 GCTGCTACTCGCCTTCAACTTGG + Intronic
1172930584 20:38583657-38583679 CATGCTGCAGGCCTTGGCCTGGG - Intronic
1174124953 20:48297485-48297507 CATCCTCCTTGCCTTAACCTGGG + Intergenic
1175542989 20:59759882-59759904 CCTGCTTCTCTCCTTGACCTTGG + Intronic
950355681 3:12406630-12406652 CATGATAATCGCTTTAACCTGGG - Intronic
964295823 3:155232116-155232138 CATGCTACCTGCCTGGCCCTAGG + Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
967219662 3:187237801-187237823 CAGGCTACACTCCTTGGCCTGGG + Intronic
970260610 4:14220559-14220581 CATCCTACTGACCTTGCCCTGGG + Intergenic
972516786 4:39816648-39816670 CATGAGAATCGCCTGGACCTGGG - Intergenic
985555753 5:557181-557203 CCTCCCACTGGCCTTGACCTTGG - Intergenic
986961808 5:13222046-13222068 CATGCTGCTCGCTTTGAAGTTGG + Intergenic
988201261 5:28072270-28072292 CATGCTACTTTTCTTGCCCTTGG + Intergenic
996034103 5:118739053-118739075 CATGCTACTCGCCTTCTCTTTGG - Intergenic
996691181 5:126341933-126341955 GCTGCTTCTGGCCTTGACCTTGG - Intergenic
1002635316 5:180604586-180604608 CAGGCCTCTCGCCTTGACCTAGG + Intronic
1003753835 6:9093393-9093415 CATGCAATTCCCCTTGACCCAGG + Intergenic
1007319148 6:41013946-41013968 TATGCTGCTTTCCTTGACCTTGG + Intergenic
1011014912 6:82743928-82743950 CATGCTAATCGCTTGAACCTGGG + Intergenic
1011675541 6:89729773-89729795 CATGCTAGTGGCCTAGAACTGGG - Intronic
1017349458 6:153422409-153422431 CATGCTGCTGGATTTGACCTAGG - Intergenic
1017514384 6:155142562-155142584 CATGCTACAAGCCATGACCCGGG - Intronic
1021326162 7:19272425-19272447 CATGTTACTGGATTTGACCTAGG + Intergenic
1024204190 7:47141411-47141433 GATGCTTCTCTCCTTGGCCTTGG + Intergenic
1033213726 7:139479495-139479517 CATGCTACTCCTCTACACCTTGG + Intronic
1034338955 7:150340424-150340446 CATGCTACTCACCGTGTCCACGG + Exonic
1039013727 8:33123612-33123634 CATGGTACTGGATTTGACCTAGG - Intergenic
1040610519 8:48977853-48977875 CATGGGGCTCGCCTTGACCACGG + Intergenic
1043175446 8:77018846-77018868 CATGCCTCTCTCCTTGACTTTGG + Intergenic
1047583577 8:126243905-126243927 CAGGCTACTCTCCTTGAACGAGG + Intergenic
1055899136 9:81214161-81214183 CATGCTGATGGCCTTGATCTTGG + Intergenic
1056727881 9:89138056-89138078 GATGCTTCTCGCCTTGCCCTGGG + Intronic
1185760553 X:2687375-2687397 CCTCCTACTTGCCCTGACCTAGG + Intergenic
1186363973 X:8872588-8872610 CATGCTACTGGCCTTGAAAATGG + Intergenic
1189130178 X:38490286-38490308 CTTGCTACCCTGCTTGACCTTGG + Intronic
1192536019 X:71928530-71928552 CATGCAACTCCCCTTGCCCAGGG - Intergenic
1198052810 X:132964810-132964832 CAGGATAATCGCCTGGACCTGGG + Intergenic