ID: 1073101567

View in Genome Browser
Species Human (GRCh38)
Location 10:101009249-101009271
Sequence TTTCCTCAGTGGGGCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073101567_1073101582 29 Left 1073101567 10:101009249-101009271 CCTGCAGGGCCCCACTGAGGAAA 0: 1
1: 0
2: 3
3: 16
4: 226
Right 1073101582 10:101009301-101009323 CTTCACCATGGGCTGCACCTTGG 0: 1
1: 0
2: 1
3: 20
4: 207
1073101567_1073101581 18 Left 1073101567 10:101009249-101009271 CCTGCAGGGCCCCACTGAGGAAA 0: 1
1: 0
2: 3
3: 16
4: 226
Right 1073101581 10:101009290-101009312 ATCTTCTCTATCTTCACCATGGG 0: 1
1: 0
2: 1
3: 11
4: 212
1073101567_1073101573 -8 Left 1073101567 10:101009249-101009271 CCTGCAGGGCCCCACTGAGGAAA 0: 1
1: 0
2: 3
3: 16
4: 226
Right 1073101573 10:101009264-101009286 TGAGGAAAGCGGCCCCCCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 100
1073101567_1073101580 17 Left 1073101567 10:101009249-101009271 CCTGCAGGGCCCCACTGAGGAAA 0: 1
1: 0
2: 3
3: 16
4: 226
Right 1073101580 10:101009289-101009311 GATCTTCTCTATCTTCACCATGG 0: 1
1: 0
2: 2
3: 43
4: 191
1073101567_1073101572 -9 Left 1073101567 10:101009249-101009271 CCTGCAGGGCCCCACTGAGGAAA 0: 1
1: 0
2: 3
3: 16
4: 226
Right 1073101572 10:101009263-101009285 CTGAGGAAAGCGGCCCCCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073101567 Original CRISPR TTTCCTCAGTGGGGCCCTGC AGG (reversed) Intronic
901810446 1:11764324-11764346 TTTAATCAGATGGGCCCTGCGGG - Exonic
901811902 1:11772145-11772167 TGTCCTCTGTGTGGCCCTGGTGG - Exonic
902386330 1:16078020-16078042 ATTCCACTGTGAGGCCCTGCAGG - Intergenic
903694985 1:25199942-25199964 TGACCAGAGTGGGGCCCTGCCGG - Intergenic
904080313 1:27868415-27868437 TTGTCTCAGAGGGGCCATGCAGG + Intergenic
904870694 1:33616010-33616032 TTTCCTCAGATCAGCCCTGCAGG - Intronic
906247613 1:44288125-44288147 TGTCCTCAGTGTGGCCCCTCTGG - Intronic
908842265 1:68292055-68292077 TGTCCTCAGTGGGAGCCTTCAGG - Intergenic
910387921 1:86704950-86704972 CTTCCTCAGTCGCGCCGTGCAGG + Exonic
912095820 1:106142045-106142067 TTTCCACAGTGGGTCCCACCTGG + Intergenic
912421333 1:109544138-109544160 TCTCCTCAATGGAGCCCTCCCGG - Exonic
913542598 1:119836156-119836178 TTTCCTCCGGGGAGTCCTGCAGG + Intergenic
914350732 1:146837595-146837617 TTTCCTTAATGGGGGTCTGCTGG + Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
916157749 1:161872503-161872525 TTTCCTCTGTGTTTCCCTGCTGG - Intronic
917683417 1:177391590-177391612 CTTCCTTGTTGGGGCCCTGCTGG - Intergenic
917732114 1:177884962-177884984 TTTCCTAACAGGGGCACTGCTGG - Intergenic
919220626 1:194624707-194624729 TTTCCCCTCTGGTGCCCTGCTGG + Intergenic
919939505 1:202276542-202276564 CATCCCCAGTGGGGTCCTGCTGG + Intronic
920052837 1:203173901-203173923 ATACCTCACTGGGGCCCCGCAGG - Intronic
923049415 1:230380407-230380429 ATACCTAAGTGGGGCCCTGCAGG + Intronic
1064317259 10:14269941-14269963 TGTCCTCAGTGGGGCCCAGATGG + Intronic
1064937054 10:20689560-20689582 ATACCTCAGAGGGGCCCTGATGG + Intergenic
1067107504 10:43375865-43375887 TTTCCTGACTGGGGCCCTTCAGG - Intronic
1067425214 10:46204675-46204697 TTTCCTAGCGGGGGCCCTGCGGG - Intergenic
1067943293 10:50674709-50674731 TTTCCTAGCGGGGGCCCTGCGGG - Intergenic
1069690423 10:70348200-70348222 GTTCCACAGAAGGGCCCTGCTGG + Intronic
1070269977 10:74944189-74944211 TTCCCTGAGTTGGGCCCTGATGG + Intronic
1070864631 10:79700489-79700511 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1070878421 10:79838619-79838641 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1071631534 10:87222718-87222740 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1071644976 10:87354930-87354952 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1072460093 10:95610811-95610833 ATTCCTCATTGGGGCCCTACTGG + Intronic
1073101567 10:101009249-101009271 TTTCCTCAGTGGGGCCCTGCAGG - Intronic
1073349955 10:102812702-102812724 CCTCCACAGTGTGGCCCTGCAGG + Exonic
1073588100 10:104730560-104730582 TTTCCTCAGCTGGGCCCTTAGGG + Intronic
1075398073 10:122142194-122142216 TTTCCTCTGTGGAGCCCCGAGGG + Intronic
1076030145 10:127150350-127150372 TTTGCTCAGTGGGACCCTGAGGG + Intronic
1076481771 10:130789418-130789440 TTTCCACACTGGGCCCTTGCTGG - Intergenic
1076489611 10:130849039-130849061 TTTCTTCTGTGTGGCCCTGCAGG + Intergenic
1076560380 10:131359195-131359217 CTTCCTAAGTGGGGCTCTGAGGG - Intergenic
1076842958 10:133055615-133055637 TTTCCTCAGTGAGGTCATTCAGG - Intergenic
1076879254 10:133231825-133231847 TTTACTCAGTGGGGCTCCCCGGG - Intergenic
1077453567 11:2664920-2664942 TCACCTCTCTGGGGCCCTGCGGG - Intronic
1079116787 11:17645309-17645331 AGTCCTCAAGGGGGCCCTGCTGG + Intronic
1080588806 11:33703797-33703819 TTTCTTCAGTGTGACCCTTCTGG - Intronic
1082862949 11:57872962-57872984 TTCCCTCAATGGGTTCCTGCTGG - Intergenic
1084012723 11:66361669-66361691 TTTCCCCAGCTGGGCCCTGAGGG - Intronic
1085282503 11:75340431-75340453 TTTCCCCAGAGGGGCCTTGGAGG - Intronic
1088194044 11:107256537-107256559 TTCCCTCTGTGGAGGCCTGCAGG - Intergenic
1090044302 11:123317286-123317308 TGGCCTCAGTGAGTCCCTGCGGG - Intergenic
1092192273 12:6529620-6529642 TGTGCTGAGCGGGGCCCTGCAGG + Intronic
1092263763 12:6965877-6965899 TTGCTTCTGTGGGGTCCTGCAGG - Intronic
1092282336 12:7108035-7108057 TTTGCTCTGTGGGGCCCAGATGG + Intronic
1093135619 12:15446839-15446861 TTTCCTCAACGGCTCCCTGCTGG - Intronic
1096513152 12:52143025-52143047 TGTCCTCAGGAGGGCTCTGCAGG + Intergenic
1098239599 12:68453348-68453370 TTCCCTTATTGGGCCCCTGCAGG + Intergenic
1100281237 12:93120224-93120246 TGTCCACAGTGGGCCCCTGCTGG - Intergenic
1102588065 12:113937065-113937087 TTTCTTCTGTGGGGCTGTGCTGG + Exonic
1104600188 12:130148215-130148237 CTTCCTCAGTGGGGCCCTGGTGG + Intergenic
1104870886 12:131994569-131994591 TTTCCACAGTGGGGCTCTGCAGG + Intronic
1110479553 13:75958486-75958508 ATTCCTCAATAGGGCCCTGGTGG + Intergenic
1112578942 13:100662102-100662124 TATCCTCAGTGGAGGCCTGGAGG - Intronic
1115985839 14:39103066-39103088 TTTCCTCACTGTCCCCCTGCAGG + Exonic
1118846660 14:69552532-69552554 TGTCATCAGTGGGGCACTGCAGG - Intergenic
1118851451 14:69587004-69587026 ATTCCTCAGGGAAGCCCTGCAGG - Intergenic
1121637530 14:95463750-95463772 GCTCCTCTCTGGGGCCCTGCGGG + Intronic
1124101437 15:26697770-26697792 TTTCTTCAGTGAGGGCTTGCAGG - Intronic
1124254844 15:28132025-28132047 TTTTCCCAGAGGGGCCCTGGGGG + Intronic
1125729080 15:41882725-41882747 GTCCCTCAGGCGGGCCCTGCTGG - Exonic
1127726871 15:61758961-61758983 TTGCCTCAGTGGGGCAATGGTGG - Intergenic
1128527836 15:68424480-68424502 TCTCCACATTGGGGCCCAGCAGG - Intronic
1128727446 15:69998673-69998695 TCTCCTCAGTGCGGGCCAGCCGG + Intergenic
1128750141 15:70143036-70143058 TGTCCTCAGGGTGACCCTGCGGG + Intergenic
1129663217 15:77564907-77564929 TTCCCTCAGAGGGGGCCTGGAGG + Intergenic
1129696476 15:77743174-77743196 ACTCCTCAGTGAGGCCCTCCTGG - Intronic
1130042006 15:80413166-80413188 TGGCCTCAGTGGGCCGCTGCAGG + Intronic
1132198606 15:99932464-99932486 AGTCCTCAGTGGGAGCCTGCTGG + Intergenic
1132826350 16:1907497-1907519 GCTCCTCAGTGTGGCCGTGCAGG - Intergenic
1134169761 16:11958966-11958988 TTGCCAAAGTGGGGCTCTGCAGG + Intronic
1139983303 16:70877949-70877971 TTTCCTTAATGGGGGTCTGCTGG - Intronic
1141041348 16:80675381-80675403 TTTCCTCAGTGGTTCTCTGATGG - Intronic
1141267753 16:82512275-82512297 TATCCTCAGTGGGCCCATGGAGG + Intergenic
1141464088 16:84195428-84195450 TCACCTCAGCAGGGCCCTGCGGG - Exonic
1141666174 16:85466448-85466470 TGGCCTCAGAGGGGCCCTCCTGG + Intergenic
1142349536 16:89573835-89573857 TTTCCTGTGTCTGGCCCTGCAGG + Intergenic
1143367675 17:6418919-6418941 TTTCACCAGTGTGGCTCTGCAGG - Intronic
1143780337 17:9225783-9225805 TTTCCTAATTGGCCCCCTGCCGG - Intronic
1144854625 17:18261027-18261049 TTTGCGCAGCGGGGCCCTGGAGG - Intronic
1147371523 17:39996161-39996183 TTTCCTCTTTGGGGGCCTGCAGG + Exonic
1148236366 17:45971866-45971888 CGTCCTCAGTGGGGGTCTGCAGG - Exonic
1148472893 17:47906519-47906541 TTTCCTCAGAGAGGCCTTTCTGG - Intronic
1149015827 17:51907358-51907380 TTCCTTCAGTGGGGCCTTCCCGG + Intronic
1151427532 17:74040712-74040734 GTTGATCAGTGGGGCCTTGCTGG - Intergenic
1152066880 17:78117039-78117061 TGGTCCCAGTGGGGCCCTGCGGG + Intronic
1152266626 17:79298699-79298721 CTTCCCCAGCTGGGCCCTGCCGG - Intronic
1152360916 17:79832625-79832647 CTTCCTCAGTGGGGCAGGGCCGG + Intergenic
1153068834 18:1080930-1080952 TTTCCTCTGTTGGAACCTGCTGG - Intergenic
1155375044 18:25148031-25148053 TTTTCTCAGTAGGGGCCAGCTGG - Intronic
1155404372 18:25471597-25471619 CTCGCTCAGTGGTGCCCTGCAGG - Intergenic
1157625291 18:49045748-49045770 TTTCCTGTGCGGGGCCCTCCAGG - Intronic
1158208903 18:55024104-55024126 TTTCCTAATTGGGGCACTACTGG - Intergenic
1161105700 19:2443025-2443047 GTTCATCAGTGGAGCCATGCAGG - Intronic
1161391827 19:4025140-4025162 TTCCCTCGGTGGGGCCGTCCTGG + Intronic
1161675662 19:5647160-5647182 TTTGCTTAGTGGGGCACAGCTGG + Intronic
1162241769 19:9361007-9361029 TTGCCTACGTGGGGCCCTGTTGG - Intronic
1162566002 19:11446164-11446186 GTTCCAGGGTGGGGCCCTGCAGG + Intronic
1162785039 19:13029584-13029606 TTTCCTCAGCTGGACTCTGCAGG + Intronic
1163031197 19:14545357-14545379 TTTCCTCAGCAGGGTCCTCCCGG + Intronic
1163830039 19:19543248-19543270 GTTCCACAATGGGACCCTGCTGG + Exonic
1164965101 19:32476412-32476434 TGTCCTCAGTGGGCCTCTGTGGG + Intronic
1165443358 19:35843552-35843574 TCACCTCAGTGGGGTCCTGGAGG + Exonic
1168490007 19:56801445-56801467 TTTCCGCACTGGGGATCTGCTGG - Intronic
925589243 2:5493552-5493574 TTTCCTCTCCGGGGCCCTGGAGG + Intergenic
926344829 2:11935754-11935776 TTTCCCCACTGGGGCCCTCATGG - Intergenic
927007276 2:18863921-18863943 TTTCCACAGTGGGGCCTGACAGG + Intergenic
927085148 2:19667695-19667717 ATTTCCCAGTGGGGTCCTGCAGG - Intergenic
934656397 2:96118632-96118654 CGTCCTCAGTGGGGACTTGCAGG - Intergenic
936505273 2:113100569-113100591 CCTCCTAAGTGGGGCCCTGTAGG - Intergenic
937336605 2:121066129-121066151 TCTCCTCTGTGGGGCCGAGCAGG + Intergenic
942519460 2:176788142-176788164 TTCCCAGAGTGGGTCCCTGCAGG - Intergenic
945097067 2:206230194-206230216 TTCCCTCAGTGGAGCCCCACTGG + Intergenic
945119676 2:206444115-206444137 TTTCCTCTGCAGGGCCCCGCGGG - Intronic
945437932 2:209840726-209840748 TTTCCTTATTTGGCCCCTGCAGG - Intronic
946179702 2:217942098-217942120 ATTCTTCACTGGGGCCTTGCGGG + Intronic
946324212 2:218975620-218975642 TTTCCTAACTGAGGCGCTGCAGG - Intergenic
946596332 2:221309776-221309798 TCGCCTCTGTGGGACCCTGCAGG + Intergenic
946987760 2:225292117-225292139 TTTCCTCCGTGGGTCCCCTCAGG - Intergenic
947595667 2:231410033-231410055 TTTCCAGAGTGGGGCCCCACTGG - Intergenic
947904172 2:233747674-233747696 TTACCTCTGTGGGGCAGTGCTGG + Intronic
949027951 2:241775079-241775101 TGTTGCCAGTGGGGCCCTGCTGG - Intergenic
1168763016 20:362585-362607 TTCCATCACAGGGGCCCTGCTGG - Intergenic
1170116818 20:12869328-12869350 GTTCCTCAATGTGGCCCTGAAGG - Intergenic
1170799505 20:19579373-19579395 TTTACTCACTGGATCCCTGCAGG - Intronic
1172026160 20:31950278-31950300 TTTTCTCAGTGCAGCCCTGGAGG - Intronic
1172399805 20:34640124-34640146 TTCTCTCAGTGCAGCCCTGCTGG - Intronic
1172598657 20:36168354-36168376 TGTCATCAGTCTGGCCCTGCTGG + Intronic
1173807825 20:45937507-45937529 TTGCCTCTGTGGGACCCTGTGGG + Exonic
1175728474 20:61335461-61335483 GTTACTCAGTGGGGCCTTCCAGG + Intronic
1177613756 21:23489789-23489811 TTTCCTCTGTGTGGCAGTGCTGG - Intergenic
1178670812 21:34590181-34590203 TATCCTCAGAGCGGCCCTCCAGG + Intronic
1178716538 21:34969381-34969403 TTTTCTCTGTTGGCCCCTGCAGG - Intronic
1178755791 21:35348334-35348356 AGTCCTCAGTTGGGCCCAGCAGG - Intronic
1179487170 21:41717733-41717755 TTTCTTCATGGCGGCCCTGCAGG - Intergenic
1179525964 21:41976028-41976050 TTGCCTCAGGAGGGCCCTGCAGG - Intergenic
1181446827 22:22983302-22983324 TTTCCTGTGGGGGGCCCAGCAGG - Intergenic
1182299945 22:29331721-29331743 TGACCCCAGTGGGGCCCGGCTGG + Intronic
1182728730 22:32470423-32470445 TTTCCTTACTTTGGCCCTGCTGG + Intergenic
951685164 3:25335654-25335676 CTTCCTGAGAGGGGCCTTGCTGG + Intronic
957640702 3:82849879-82849901 TTTCCACTGCAGGGCCCTGCAGG - Intergenic
958094703 3:88928938-88928960 TTTTCTTCCTGGGGCCCTGCAGG + Intergenic
959930699 3:111979019-111979041 GTCCCTCAGTGGGACACTGCAGG + Exonic
961354433 3:126327076-126327098 TTTCCACAGAGGTGCCTTGCCGG + Intergenic
961381546 3:126499095-126499117 TGTTCTCACTGAGGCCCTGCAGG + Intronic
961942239 3:130650190-130650212 CTTCATCACTGGGGACCTGCTGG + Intronic
962165291 3:133041118-133041140 TTAATTCAGTGGGGCTCTGCTGG + Intronic
962892576 3:139685464-139685486 TTTTCACAGTGGTGCCCTGGTGG + Intergenic
965865152 3:173196635-173196657 TTTCTTCAGTGTGGCCCCTCAGG - Intergenic
966400934 3:179546479-179546501 TTTCCTCAGTGTGGCCAAGTTGG - Intergenic
968503959 4:963487-963509 TGTCCTCAGTGCCGCCCTGCTGG - Intronic
968895519 4:3399907-3399929 CTTCCTAAATGGGGCACTGCAGG + Intronic
969316310 4:6383265-6383287 GTGGGTCAGTGGGGCCCTGCTGG - Intronic
973164401 4:47058610-47058632 TTTCCGCAGAGGTGCCCTGGGGG + Intronic
973262819 4:48181826-48181848 TTTCCACAGTGGGGCCCTTTAGG + Intronic
978437568 4:108701990-108702012 ATTCCTCAGAGGGACCCTGGAGG - Intergenic
978819501 4:112949268-112949290 TTTCCTAAGTGAAGCCATGCAGG - Intronic
982896078 4:160928713-160928735 AAGCCTCAGTGTGGCCCTGCTGG - Intergenic
984608745 4:181814530-181814552 TTTCCTATGAGGGGCTCTGCAGG - Intergenic
985922719 5:2992128-2992150 TTTCCTCTCTCGAGCCCTGCGGG + Intergenic
989821278 5:45797738-45797760 ATTCCTCAGTGGGGGCATGAAGG - Intergenic
990163026 5:52964195-52964217 TTTTGTTAGTGGGTCCCTGCGGG + Intergenic
991094719 5:62727668-62727690 CTGACACAGTGGGGCCCTGCTGG + Intergenic
995498284 5:112772916-112772938 TTTCCCTAGTGAGGACCTGCAGG - Intronic
997209883 5:132071008-132071030 TTTCGGCAGTGGTGGCCTGCAGG - Intergenic
1002040410 5:176509574-176509596 TACCCTCAGTGGAGCCCTTCTGG + Exonic
1004299450 6:14444005-14444027 GTTCCCCCGTGGGGCCCTGGTGG - Intergenic
1006451746 6:34109409-34109431 AGGCCTCAGTGGGTCCCTGCAGG + Intronic
1007282327 6:40721767-40721789 CTTCCTCCCTGGGGCCCTGAAGG + Intergenic
1007702477 6:43772978-43773000 TTTCCTCCTTGGGGCCCAGGAGG + Intronic
1011529417 6:88303945-88303967 ATTTCTCACTGGGGCCATGCTGG - Intergenic
1017662879 6:156690996-156691018 TCTCCCCAGTGGGGCTCAGCAGG + Intergenic
1017960684 6:159218197-159218219 TTTCTTCAGTGGTGAACTGCTGG + Intronic
1019501335 7:1366344-1366366 TGTCCTCAGTCGGACCCTCCTGG - Intergenic
1020044687 7:5032092-5032114 CTTCCTCAGGAGGGCTCTGCTGG + Intronic
1020156403 7:5728197-5728219 CTTCCTCAGGGTGGCCCTTCTGG + Intronic
1020290041 7:6716114-6716136 CTTCCTCAGGAGGGCTCTGCTGG + Intergenic
1022210546 7:28204736-28204758 TTTCCTCTGTGTGGCCCTCTAGG - Intergenic
1023621967 7:42082537-42082559 AGTCCTCAGCGGGGCCCTGTGGG - Intronic
1023825642 7:44007112-44007134 CTTCCTCAGGAGGGCTCTGCTGG - Intronic
1026005696 7:66598711-66598733 TCTGCTCAGTGGGATCCTGCAGG + Intergenic
1026089194 7:67285888-67285910 CTTCCTCAGGAGGGCTCTGCTGG - Intergenic
1026725057 7:72864462-72864484 CTTCCTCAGGAGGGCTCTGCTGG + Intergenic
1026747189 7:73022658-73022680 CTTCCTCAGGAGGGCTCTGCTGG + Intergenic
1026750839 7:73050801-73050823 CTTCCTCAGGAGGGCTCTGCTGG + Intergenic
1026754488 7:73078911-73078933 CTTCCTCAGGAGGGCTCTGCTGG + Intergenic
1026758140 7:73106944-73106966 CTTCCTCAGGAGGGCTCTGCTGG + Intergenic
1026968880 7:74455833-74455855 TTTCCTCTGTGGGGTCCTGTGGG - Intronic
1027033293 7:74907229-74907251 CTTCCTCAGGAGGGCTCTGCTGG + Intergenic
1027089265 7:75286540-75286562 CTTCCTCAGGAGGGCTCTGCTGG - Intergenic
1027092908 7:75314468-75314490 CTTCCTCAGGAGGGCTCTGCTGG - Intergenic
1027096551 7:75342435-75342457 CTTCCTCAGGAGGGCTCTGCTGG - Intergenic
1027118784 7:75501206-75501228 CTTCCTCAGGAGGGCTCTGCTGG - Intergenic
1027273012 7:76534253-76534275 CTTCCTCAGGAGGGCTCTGCTGG + Intergenic
1027322796 7:77025245-77025267 CTTCCTCAGGAGGGCTCTGCTGG + Intergenic
1027326461 7:77053337-77053359 CTTCCTCAGGAGGGCTCTGCTGG + Intergenic
1028460515 7:91086639-91086661 CTTCCTCACTGGGCCCCTGTGGG + Intronic
1028953504 7:96663546-96663568 CTTTCTCAGTGTGGCACTGCAGG - Intronic
1029397660 7:100319409-100319431 CTTCCTCAGGAGGGCTCTGCTGG - Intronic
1029718703 7:102348811-102348833 CTTCCTCAGGAGGGCTCTGCTGG + Intergenic
1029753912 7:102560444-102560466 CTTCCTCAGGAGGGCTCTGCTGG - Intronic
1029771862 7:102659534-102659556 CTTCCTCAGGAGGGCTCTGCTGG - Intronic
1032454982 7:132066404-132066426 TTTGCTCAGTGGGGCACAGGGGG - Intergenic
1032483214 7:132263083-132263105 TTTCCTCAGTGGTCCTGTGCAGG - Intronic
1033043633 7:137940834-137940856 TTTCCCCAGTGTGGCCCTCTAGG - Intronic
1034115010 7:148576801-148576823 TTTCCCAAGTGGGTCCCTGAAGG + Intergenic
1035067928 7:156121647-156121669 GCTCCTCACAGGGGCCCTGCTGG - Intergenic
1035567879 8:653781-653803 TCTCCTCAGTGCCACCCTGCGGG - Intronic
1042178917 8:66065349-66065371 TGTCCTCAGTGGGGCCTTGCTGG + Intronic
1045072219 8:98519745-98519767 TTTCTTCAGTGTGGCCCTGGAGG + Intronic
1046385763 8:113507402-113507424 TTTCCTCAGTTTGCCTCTGCTGG + Intergenic
1047666237 8:127094972-127094994 TTTTCTCAGTGCTGCACTGCTGG + Intergenic
1049203108 8:141351386-141351408 CTTCCTCATTGGAGCCCTCCTGG + Intergenic
1049489637 8:142888485-142888507 TTTAATCAGTGAGGCCCTGTGGG - Intronic
1051007776 9:12368730-12368752 TTACCACGGTGGAGCCCTGCAGG + Intergenic
1052278711 9:26707983-26708005 TTTCCTCAGTGGGTGCATGTGGG + Intergenic
1053302533 9:36962123-36962145 ATTCCTCATTGGGGCCAGGCAGG - Intronic
1056634203 9:88318201-88318223 ATTCCTCAAAGCGGCCCTGCAGG - Intergenic
1057356129 9:94332740-94332762 GGTCCTTAGCGGGGCCCTGCGGG + Intergenic
1057651621 9:96924888-96924910 GGTCCTTAGCGGGGCCCTGCGGG - Intronic
1057957076 9:99418704-99418726 TATCCCCAGTGGGGACCTGGTGG - Intergenic
1058532856 9:105924280-105924302 GTTCCTCAGTGAGGCCTTCCTGG + Intergenic
1058984051 9:110195507-110195529 TTCCCTCAGTGGCGCCATCCTGG - Intronic
1060399303 9:123338839-123338861 TCTCCTCAGTGTGGCCCTTGAGG - Intergenic
1061231527 9:129318623-129318645 TTTCCTAAGTGAGCCACTGCAGG + Intergenic
1062623683 9:137433717-137433739 ATTCCTCAGAGGGGGCCTCCTGG - Intronic
1203785799 EBV:126798-126820 TTCCCTCGGTGGTGTCCTGCCGG + Intergenic
1185837689 X:3360625-3360647 TTTGCGCAGTGGGGCACTGAAGG - Intergenic
1186284896 X:8032859-8032881 TTTCCTCAGTCGGCACCTGCAGG + Intergenic
1187545932 X:20252642-20252664 TGTCATCAGTGGGGCCCAGCAGG - Intronic
1187929085 X:24277462-24277484 TCTTCTCAGTGCGGTCCTGCAGG - Intergenic
1189186538 X:39060066-39060088 TTTCCTCAGTGGCCAGCTGCAGG + Intergenic
1190055483 X:47178995-47179017 TTTCCTTCCTGGGGCACTGCGGG + Intronic
1197380818 X:125736695-125736717 CTACCTCAGTGTGGCCCAGCTGG + Intergenic
1197900045 X:131361055-131361077 TTGCGACAGTGGGGCCCCGCAGG - Intronic
1199171518 X:144739592-144739614 AGTCTTCAGTGGGCCCCTGCTGG - Intergenic
1201238138 Y:11931110-11931132 TTTGCGCAGTGGGGCACTGAAGG + Intergenic