ID: 1073102563

View in Genome Browser
Species Human (GRCh38)
Location 10:101014314-101014336
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073102551_1073102563 7 Left 1073102551 10:101014284-101014306 CCAGCCAGGGCTCCATCGCAGAG No data
Right 1073102563 10:101014314-101014336 TCTCTTGGTGTGGGGGGCTTGGG No data
1073102555_1073102563 -5 Left 1073102555 10:101014296-101014318 CCATCGCAGAGGGTCTGATCTCT 0: 1
1: 0
2: 1
3: 3
4: 89
Right 1073102563 10:101014314-101014336 TCTCTTGGTGTGGGGGGCTTGGG No data
1073102554_1073102563 3 Left 1073102554 10:101014288-101014310 CCAGGGCTCCATCGCAGAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1073102563 10:101014314-101014336 TCTCTTGGTGTGGGGGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr