ID: 1073106940

View in Genome Browser
Species Human (GRCh38)
Location 10:101037485-101037507
Sequence CTGGAGAGAGAGTTGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 691
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 641}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073106940 Original CRISPR CTGGAGAGAGAGTTGGGGCC TGG (reversed) Intronic
900244204 1:1630127-1630149 TTGGAGGCAGAGGTGGGGCCCGG - Intronic
900581792 1:3413148-3413170 CTGGAGAGAGGGGTGGGGAAGGG - Intronic
900624336 1:3601195-3601217 CTGGAGAGAGTGCTGGTGGCCGG - Intronic
901212554 1:7534726-7534748 CAGGGGGCAGAGTTGGGGCCTGG + Intronic
901263823 1:7893958-7893980 CTAGAGAGAGAATTCGGGTCTGG + Intergenic
901266395 1:7914097-7914119 TGGGAGGGAGAGTTGGGGCTGGG - Intergenic
901768610 1:11519332-11519354 CTGTGGAGAGAGTAGGGGACAGG - Intronic
901860486 1:12071209-12071231 GTGGGCAGATAGTTGGGGCCAGG + Intronic
902163434 1:14550894-14550916 CTGGGGAGAGAGCTGGGGATGGG - Intergenic
902167940 1:14587589-14587611 CAGGAGTGAGAGTGGGGGGCGGG + Intergenic
902585456 1:17436567-17436589 CTGGAGACAGAGGTGGGCCAGGG + Intronic
902841819 1:19079333-19079355 CGGGAGAGAAAGTGGGGGCTTGG - Intronic
903234260 1:21939213-21939235 CTGGAGCCTGGGTTGGGGCCAGG - Intergenic
903250349 1:22048861-22048883 ATGGATTGAGAGTTGGGGCAGGG + Intergenic
903297153 1:22350969-22350991 CAGGAGAGAGGGTGGGGGCGGGG - Intergenic
903301112 1:22379392-22379414 CGGGGGAGAGAGTTGAGGCCAGG + Intergenic
904028757 1:27520955-27520977 CTGAAGGGTGAGTTGGGGCATGG + Intergenic
904039770 1:27577094-27577116 CTGGAGAGGGAGTGAGGGACAGG - Intronic
904043831 1:27598950-27598972 TTGGAGAGGGAGTGGGGGACAGG - Intronic
904074722 1:27831274-27831296 TTGGAGGTAGGGTTGGGGCCGGG - Intronic
904136177 1:28314272-28314294 CTGGACAGAAAGGTGGAGCCTGG + Intergenic
904421822 1:30399006-30399028 CTGCAGAGAGAGATGGGGGTGGG + Intergenic
904684391 1:32250103-32250125 CTGCAGAGAGAAGTGGGGGCAGG - Intergenic
904738798 1:32655710-32655732 CAGGAGAGAAAGTTGGGGTAAGG - Intronic
905018416 1:34792892-34792914 CTGGAGAGAGGGCGGGGGCGGGG - Intronic
905205955 1:36342941-36342963 CTGGAGAAAGTGTTGGGCCTAGG - Intronic
905301062 1:36986399-36986421 ATGGACAGAGAGATGGGGACAGG - Intronic
905395007 1:37661278-37661300 ATGGAGGGAGAGGTGAGGCCGGG - Intergenic
906078792 1:43070135-43070157 ATGGAGAGAATGTTGGGGCTGGG - Intergenic
906210760 1:44011163-44011185 CTGAAGAGGGAGCTAGGGCCAGG + Intronic
906213009 1:44022580-44022602 CTGGCCTGAGGGTTGGGGCCAGG + Intronic
906326510 1:44849510-44849532 CTGGAGACAGAGTCCTGGCCTGG - Intergenic
906596141 1:47079234-47079256 CTGGAGAGGGATGTGGGGCAAGG + Intronic
907264824 1:53251356-53251378 GTGGAGAGTGGGATGGGGCCAGG + Intronic
907454690 1:54567785-54567807 CTGGGCAGAGAGGTGGAGCCAGG - Intronic
907635374 1:56129328-56129350 ATGGAGAGAGAGATGTGGACAGG - Intergenic
908797159 1:67841974-67841996 CTGCAGGTAGAGTTGGAGCCAGG - Intergenic
909013173 1:70356386-70356408 CTAGAGAGAGAGGAAGGGCCAGG + Intronic
909056228 1:70824540-70824562 CTGGAGACATAGTCGGGGCCAGG - Intergenic
910783299 1:90966044-90966066 TGAGAAAGAGAGTTGGGGCCAGG - Intronic
912420437 1:109539098-109539120 AAGGAGACAGAGTGGGGGCCAGG - Intergenic
912500992 1:110121739-110121761 TTGGTGACAGAGTTGGGGCCAGG + Intergenic
912567837 1:110601186-110601208 ATGGGGAGAGAGTTTGGGTCTGG + Intronic
912572436 1:110634333-110634355 CTGGAGACCAAGGTGGGGCCAGG - Intergenic
912722554 1:112032363-112032385 AGAGAGAGAGAGTTGGGGCAGGG + Intergenic
914013333 1:143795648-143795670 TTGGAGAGGGAGTTGGGTTCAGG - Intergenic
914314774 1:146499913-146499935 CAGGTGAGAGTGTTGGAGCCAGG + Intergenic
914379327 1:147102461-147102483 CAGGTGAGAGTGTTGGAGCCAGG + Intergenic
914499577 1:148233475-148233497 CAGGTGAGAGCGTTGGAGCCAGG - Intergenic
914941182 1:152024211-152024233 CGGTGGAGAGAGGTGGGGCCGGG + Intergenic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
916071210 1:161171116-161171138 CTGTATAGAGAGTGGGCGCCAGG + Exonic
917443927 1:175090921-175090943 CTGGGGAGGATGTTGGGGCCAGG + Intronic
917521175 1:175749530-175749552 TAGGAGAGAGATTTGGGGCAGGG - Intergenic
917584999 1:176417146-176417168 CTGGAAAGAGAGCTGAAGCCAGG - Intergenic
917851560 1:179069049-179069071 CTTCAGAGGGAATTGGGGCCAGG + Intronic
918451176 1:184660870-184660892 CTGCAGAGGGTTTTGGGGCCAGG - Intergenic
919954804 1:202403145-202403167 CAGTAGAGAGAGATGGGGCCTGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920423157 1:205849752-205849774 CTGGGAAGGGTGTTGGGGCCGGG + Intronic
920906485 1:210174580-210174602 CTGCTGAGAGAATTGGGGGCCGG + Intergenic
921468745 1:215523044-215523066 CTGGAGATGGGGTTGGGGGCAGG - Intergenic
921622362 1:217340012-217340034 CTGGTGAGTGGGTTGGGGGCAGG - Intergenic
921669665 1:217912132-217912154 CTGGAGACAGACATGGGGTCGGG + Intergenic
921888520 1:220330416-220330438 CTGGAGGGAGAGAGGGGGCTGGG - Intergenic
922237760 1:223734596-223734618 AAGGAGAGAGGGTTGTGGCCGGG - Intronic
922335290 1:224614376-224614398 CTGGAGGGAGATATGAGGCCAGG + Intronic
922628323 1:227076550-227076572 CAAGAGATAGTGTTGGGGCCAGG - Intronic
923377141 1:233375235-233375257 CTTGAAAGTGATTTGGGGCCAGG - Intronic
923457345 1:234175925-234175947 CTGGAGAAAGATTGGAGGCCAGG - Intronic
923568065 1:235091504-235091526 CTCTAGAGAGAGATGTGGCCAGG + Intergenic
924049901 1:240070244-240070266 CTGGAAAGAGAATTGAGGTCTGG + Intronic
1062986622 10:1775078-1775100 GAGCAGAGAGAGGTGGGGCCAGG + Intergenic
1063848671 10:10160890-10160912 GTGGAGAGAGAGGTGCGGGCAGG + Intergenic
1063960431 10:11301541-11301563 CTGGAACGGGAGTCGGGGCCGGG - Intronic
1064646426 10:17464612-17464634 CAGGAGAGATAGTGGTGGCCTGG - Intergenic
1065200003 10:23303831-23303853 CTTGAGGGAGATTTGGGACCTGG + Intronic
1065593433 10:27289020-27289042 CAGGAGAGAGGGTTGGTACCAGG - Intergenic
1065656941 10:27961345-27961367 CGGGAGAGAGGGTTGGTACCAGG + Intronic
1067250844 10:44586264-44586286 CTGGAGAGTGAATTGGAGACTGG + Intergenic
1067278595 10:44854905-44854927 CGGGAGAGGGAGCTGGAGCCGGG + Intergenic
1067413319 10:46084345-46084367 CTGGGGAGAGAACTGTGGCCAGG + Intergenic
1068330456 10:55559025-55559047 CTGGATAGAGAGTTGGCACTGGG - Intronic
1068443404 10:57089106-57089128 CTAGTGTCAGAGTTGGGGCCTGG - Intergenic
1068595197 10:58895674-58895696 CTGGAGAGACAGAGGTGGCCAGG + Intergenic
1069817918 10:71210274-71210296 CTGGAGGGAGAGCAGGGCCCGGG + Intergenic
1069896550 10:71683693-71683715 AAGGGCAGAGAGTTGGGGCCTGG + Intronic
1070278768 10:75033603-75033625 CTGGAGGTGGGGTTGGGGCCTGG + Intergenic
1070738172 10:78879233-78879255 CTGGAGAGAGATTCCAGGCCTGG + Intergenic
1070767653 10:79066027-79066049 CTGGTGGGAGAGTAGGGGGCTGG + Intergenic
1070868108 10:79722297-79722319 CCGGTGTTAGAGTTGGGGCCTGG + Intergenic
1071635018 10:87244498-87244520 CCGGTGTTAGAGTTGGGGCCTGG + Intergenic
1072009378 10:91290277-91290299 CTGCAGAAAGAGGTAGGGCCGGG + Intergenic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073181816 10:101588102-101588124 TTGGAGAGACTCTTGGGGCCGGG - Exonic
1074169580 10:110919505-110919527 CTGGAGCGAGAGTAGTGGCGGGG + Intergenic
1074613624 10:115044308-115044330 CTGGATGGATGGTTGGGGCCAGG + Intergenic
1074891883 10:117742771-117742793 CTAGAAAGAGAGGTCGGGCCAGG + Intergenic
1074925911 10:118070485-118070507 CTGGAGAGATAGGTGGGAGCTGG + Intergenic
1075104028 10:119525345-119525367 CTGGAGGGAGTGTTGGGGACTGG - Intronic
1075515451 10:123104556-123104578 CTGGAGATGGAGTTGGGGCCTGG + Intergenic
1075595654 10:123727294-123727316 CTGGAGGGAGAGATGAGGCTGGG - Intronic
1075715669 10:124553834-124553856 CTGCAGACAGAGGAGGGGCCTGG - Intronic
1076161157 10:128245263-128245285 CAAGAGAGAGGGGTGGGGCCAGG - Intergenic
1076631297 10:131853603-131853625 CTGGAGAGGAAGGTGGGACCAGG - Intergenic
1076733804 10:132450233-132450255 CTGGGGTGAGGGTTGGGGGCTGG - Intergenic
1077097329 11:804632-804654 CTGGAAAGAGGGTTGGGGAATGG + Intronic
1077106387 11:844229-844251 CTGGGGAGTGGGTGGGGGCCTGG + Intronic
1077226914 11:1442624-1442646 CTGGAGAGAGGCTGGGGGACAGG + Intronic
1077360577 11:2138765-2138787 CGGGAGAAAGAGCGGGGGCCGGG + Intronic
1077429207 11:2507683-2507705 CTGGGGAGAGAGTGCGGGCTGGG + Intronic
1077640106 11:3873652-3873674 CTGGAGTGAGGGGTGGAGCCTGG + Intronic
1077672434 11:4168149-4168171 CTGGAGGGAGTGGTGGGTCCTGG - Intergenic
1078809447 11:14743537-14743559 CTGGAAAGGGAGTTGAAGCCAGG - Intronic
1079106738 11:17576845-17576867 CTGCAGAGAGAGACGGGCCCTGG - Intronic
1079270714 11:18983230-18983252 CCTGAGACAGAGTTAGGGCCTGG - Intergenic
1079455500 11:20632728-20632750 CAGGACAGAGATTTGGGGTCAGG + Intronic
1081492770 11:43580362-43580384 ATGGGTAGAGAGTTGGGGGCGGG + Intronic
1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG + Intergenic
1082771806 11:57213591-57213613 CTTGAGAGAGAGGAGGGGCTGGG - Intergenic
1083398122 11:62405233-62405255 CTGGAGAGACAGGTGGGAACAGG + Intronic
1083458373 11:62794322-62794344 CTGGAGAGAGGGTGGGCACCGGG + Exonic
1083729728 11:64646256-64646278 AGGGAGGGAGAGTTGGGGCTGGG - Intronic
1083888454 11:65584094-65584116 CTGGCTAGAGCCTTGGGGCCAGG - Intronic
1084101122 11:66950375-66950397 CCAGAGAAAGAGGTGGGGCCGGG - Intronic
1084178126 11:67433963-67433985 CAGGAGAGAGGGTGAGGGCCTGG - Intronic
1084600213 11:70141099-70141121 TTGGACAGAGAGGTGGGACCAGG - Intronic
1084726613 11:70946294-70946316 GTGGAGAGAGAGGTTGAGCCTGG - Intronic
1084726735 11:70946769-70946791 GTGGAGAGAGAGGTTGAGCCTGG - Intronic
1084952098 11:72672100-72672122 TGGAAGAGAGAGGTGGGGCCAGG - Intronic
1084952984 11:72676947-72676969 CTGGAGAGAGGCCTGTGGCCGGG - Intergenic
1085202084 11:74707897-74707919 ATGGAGAGATAGTTGGTGGCTGG + Intronic
1085308557 11:75502146-75502168 CTGGAAAGTGAGTTGTGGGCAGG - Intronic
1085386360 11:76160451-76160473 CTGGAGAGAGACCTGGGGCCCGG + Intergenic
1085701318 11:78748464-78748486 TTGGAGAGAAAGTCAGGGCCAGG + Intronic
1086210422 11:84311751-84311773 CTGGAGAGGAGGGTGGGGCCTGG - Intronic
1087952276 11:104237463-104237485 CAGGAGATGGAGTTGGGGGCAGG + Intergenic
1088259148 11:107928398-107928420 CGGGAGAGAGAGGCGGGGCCAGG - Intergenic
1088471611 11:110193370-110193392 CGGGAGAGAGGGTTGGGGGCAGG + Intronic
1089143334 11:116305838-116305860 CTGGAGACATAGGTTGGGCCAGG + Intergenic
1089583130 11:119493953-119493975 CTGGAGAGGTAGGTGTGGCCAGG - Intergenic
1089584527 11:119502111-119502133 CTGCAGAGAGAGGCAGGGCCGGG + Intergenic
1089734591 11:120541021-120541043 CTGGAGAGAGAGGCTGGGGCAGG - Intronic
1090187735 11:124749259-124749281 CTGGAGAGAGAACTGGATCCAGG + Intronic
1090189300 11:124758245-124758267 GTGGAGAGGGAATGGGGGCCGGG - Intronic
1090260384 11:125314896-125314918 CAGGAAAGAGAGTTGGGGAAAGG + Intronic
1090318397 11:125818106-125818128 CTGGAAAGAGGGTTGAAGCCAGG + Intergenic
1090621052 11:128561556-128561578 CTGAAGAAAGAGTTGGGCCATGG + Intronic
1090658627 11:128864778-128864800 CTGCAGAGAGTGATGGGGACAGG - Intronic
1091568370 12:1663468-1663490 CTGGAGAGAGAGATGGCCTCTGG + Intergenic
1092703233 12:11256509-11256531 CTGGAAAGGGAGTTGAAGCCAGG + Intergenic
1093800756 12:23369436-23369458 TTGGAGAAAGAGTTGAGTCCGGG + Intergenic
1094308506 12:29050187-29050209 CTGGGAAGAGAGTGGGGGGCAGG + Intergenic
1095642349 12:44500391-44500413 ATGGAGGGAGAGGTGGGGGCGGG + Intergenic
1096018128 12:48296901-48296923 CTGGAGAAAGACTGGGCGCCTGG - Intergenic
1096277771 12:50225195-50225217 TTAAAGAGACAGTTGGGGCCAGG - Intronic
1096779987 12:53986081-53986103 CAGGGGAGAGGGTTGGGCCCAGG + Intronic
1098219362 12:68252421-68252443 AAGGAGAGAGAGTTGGGGTAAGG + Intronic
1099975040 12:89537713-89537735 CTGGTGAGACAGTTGGGCACAGG + Intergenic
1100659258 12:96679012-96679034 CTGAAGAGTGAGTGAGGGCCTGG - Intronic
1101175970 12:102151847-102151869 TTGGACAGTGAGTTGGTGCCAGG - Intronic
1102008914 12:109606320-109606342 CTGGGGAGTGAGCTGGGGCATGG + Intergenic
1102183478 12:110930785-110930807 CTGGAGGGTGAGGTGGGGGCCGG - Intergenic
1102289061 12:111684445-111684467 TTGGAGAGAGGGATGGGGGCAGG - Intronic
1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG + Intronic
1102521261 12:113478709-113478731 CTGGGGGAAGAGTGGGGGCCTGG - Intergenic
1103338096 12:120205059-120205081 CTGTAGATAAAGTTGTGGCCGGG + Intergenic
1103447546 12:121004057-121004079 TTGGAGAGGGAGGTGGGGCTTGG + Exonic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1103921943 12:124403759-124403781 CTGGAGAGAGCGTTGTGTGCGGG - Intronic
1104084491 12:125461500-125461522 CTGCAGAGGGATGTGGGGCCGGG + Intronic
1104748621 12:131224643-131224665 GTGGAGATAGGGGTGGGGCCAGG + Intergenic
1104784501 12:131440921-131440943 GTGGAGATAGGGGTGGGGCCAGG - Intergenic
1105296856 13:19095291-19095313 CTGGAGTGAGAATGGGAGCCTGG - Intergenic
1106029140 13:25984003-25984025 CAGGAGAAAGACTTGAGGCCAGG + Intronic
1106208313 13:27620138-27620160 CAGGAGGGAGAGTCGGCGCCCGG - Intronic
1106540500 13:30686097-30686119 CTGGAAAGAGGGTGGTGGCCTGG - Intergenic
1108161255 13:47642235-47642257 CTGGGGAAAGAGTTGAGTCCGGG - Intergenic
1108798163 13:54059091-54059113 AAGGAGAGAGACTTGAGGCCAGG + Intergenic
1108818470 13:54317881-54317903 GTGGAGAGAGAGGTGTGGGCAGG + Intergenic
1110142563 13:72148841-72148863 CTTGAGGGAGAGTTGGGACAAGG - Intergenic
1110553722 13:76835065-76835087 GTGGAGAGAGAGACAGGGCCTGG - Intergenic
1112122019 13:96423458-96423480 CTGGAGAGTGTGCTGGGGTCCGG + Intronic
1112179040 13:97058504-97058526 TTGGAGAGGGATTTGGGGTCAGG - Intergenic
1112909584 13:104464571-104464593 AGAGAGAGAGAGTTGGGGGCGGG + Intergenic
1113523324 13:110955474-110955496 CTGGACAGAGAGTCTCGGCCTGG + Intergenic
1113701982 13:112395022-112395044 CTGGACAGAGAGTCTCGGCCTGG - Intronic
1114280747 14:21191061-21191083 CTGGAGAAAGAATTGGGGCTTGG - Intergenic
1115437373 14:33390567-33390589 CTGTAGAGAGAGATGAGGGCAGG + Intronic
1117437048 14:55726078-55726100 CTGGACAGAGGGTAGGGGTCTGG + Intergenic
1118005875 14:61563800-61563822 CTGGAGAGAGAGGTGAGACCAGG - Intronic
1118167667 14:63353818-63353840 GTGGAGAGAGAGCAGGAGCCAGG - Intergenic
1118735148 14:68695787-68695809 TTAGAGGAAGAGTTGGGGCCAGG + Intronic
1119265562 14:73261677-73261699 CTGGAGGGAGGGTAGGGGTCAGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119514034 14:75233947-75233969 ATGGAAAGAGAGATGGGGCCGGG + Intergenic
1119662112 14:76459547-76459569 CTGCAGAGAGAGGGTGGGCCTGG + Intronic
1119716493 14:76863336-76863358 GTGGAGAGACAGTAAGGGCCAGG - Intronic
1119745185 14:77038829-77038851 CTCGAGCGCGCGTTGGGGCCTGG + Intergenic
1121020796 14:90578980-90579002 GAGGTGAGAGAGTTGAGGCCTGG - Intronic
1121109604 14:91303446-91303468 CTGGGGAGAGAGGTGGAGCCTGG - Intronic
1121109614 14:91303483-91303505 CTGGGGAGAGGGGTGGAGCCTGG - Intronic
1121709909 14:96030169-96030191 CAGAAGGGAGTGTTGGGGCCAGG + Intergenic
1121886634 14:97548913-97548935 CTGGAGGGAGGGTTGTGTCCTGG + Intergenic
1122071147 14:99206066-99206088 CTGGAGAGAGAATCTGGTCCAGG - Intronic
1122076341 14:99237519-99237541 CAGGAGTGGGAGGTGGGGCCTGG - Intronic
1122127294 14:99586237-99586259 CTTGGGAGACAGATGGGGCCTGG - Intronic
1122768151 14:104085510-104085532 TCGGAGAGAGAGGCGGGGCCTGG - Intergenic
1122778578 14:104134085-104134107 CTGGAGAGAGAGTAGGAGTGGGG - Intergenic
1123418968 15:20115619-20115641 CTGGAGAGAGCTTTGGGTCACGG - Intergenic
1123424183 15:20155867-20155889 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1123446897 15:20337888-20337910 CTGGAGAGAGCTTTGGGTCACGG + Intergenic
1123528189 15:21122162-21122184 CTGGAGAGAGCTTTGGGTCACGG - Intergenic
1123533403 15:21162396-21162418 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1124374731 15:29122762-29122784 GTGGACAGAAAGTTGGGCCCAGG + Exonic
1125827593 15:42689489-42689511 CTGCAGACAGAGATGTGGCCTGG - Exonic
1126315114 15:47361777-47361799 CTGGAGAGAGTGGAGGGGCGGGG - Intronic
1127286145 15:57535444-57535466 CTGGAAAGAGGGTGGGGACCTGG + Intronic
1127581972 15:60346891-60346913 CTGGAGAGAGCAGTGGGGCAGGG - Intergenic
1127858877 15:62976463-62976485 GTGGGGAGAGGGTTGGGGGCTGG + Intergenic
1128164987 15:65456132-65456154 CTTGAAAGAGAGTTGGGGGAAGG - Intronic
1128418129 15:67465838-67465860 GTGGAGAGAGAGGAGGGGTCAGG - Intronic
1128499286 15:68216206-68216228 CTAGAGAGAGAGATGAGGCCAGG - Intronic
1128591129 15:68898427-68898449 ATGGAGAGAGAGAAGGGGCAAGG - Intronic
1129160638 15:73745900-73745922 CTGGAGAGAGGGTTGGCGTCTGG - Intronic
1129462337 15:75705711-75705733 GAGGAGGGAGAGATGGGGCCTGG + Intronic
1129514897 15:76151444-76151466 CTGGAGGGTGGGTTGGGGGCTGG - Intronic
1129722518 15:77886130-77886152 GAGGAGGGAGAGATGGGGCCTGG - Intergenic
1130305371 15:82709550-82709572 CTCGCGGGAGGGTTGGGGCCGGG - Intronic
1130388512 15:83434352-83434374 TTGGAAAATGAGTTGGGGCCAGG + Intergenic
1130394961 15:83493786-83493808 CTGGAGACAGAGGTCAGGCCAGG + Intronic
1130877929 15:88030369-88030391 ATGGAGAGAGCTATGGGGCCTGG - Intronic
1131264427 15:90907166-90907188 CTGGAGAGAGTGTGTAGGCCAGG - Intronic
1131453106 15:92562639-92562661 CTGGAGAGGGAGATGGCGCCAGG + Intergenic
1131768975 15:95714254-95714276 CTGGAGAAAAAGATGGGTCCTGG + Intergenic
1132096394 15:98988154-98988176 CTGGAAAGAGGGTTGAAGCCAGG + Intronic
1132309518 15:100847020-100847042 CTGAAGAGAGAGCTGGTCCCTGG + Intergenic
1132693935 16:1193839-1193861 CTGGAGTGACAGGTGGGGGCAGG + Intronic
1132868170 16:2104044-2104066 CTGGAGAGAGAGTGGTGGAGGGG + Intronic
1132981015 16:2738761-2738783 CGGCAGAGGGGGTTGGGGCCTGG - Intergenic
1133125197 16:3641841-3641863 CTGGAAGGAGAGCAGGGGCCGGG + Intronic
1133209829 16:4257445-4257467 CTGGAGGCAGAGGTGGGGGCTGG + Exonic
1133387941 16:5385887-5385909 CTGGAGAGACAAGTGGGGGCAGG + Intergenic
1134097826 16:11430741-11430763 CAGGAGGGAGAGTTGGGTGCAGG - Intronic
1134191223 16:12122510-12122532 CTGGAGTGAGGGAGGGGGCCAGG + Intronic
1134322237 16:13174515-13174537 CTGGAGACAGAACTGGGGGCAGG + Intronic
1134515677 16:14885050-14885072 CAAAAGAGAGAGTTGGGGCATGG + Intronic
1134523604 16:14929080-14929102 CTGGAGAGAGAGTGGTGGAGGGG - Intronic
1134549293 16:15131856-15131878 CTGGAGAGAGAGTGGTGGAGGGG + Intronic
1134703350 16:16283694-16283716 CAAAAGAGAGAGTTGGGGCATGG + Intronic
1134711198 16:16327565-16327587 CTGGAGAGAGAGTGGTGGAGGGG - Intergenic
1134719050 16:16370867-16370889 CTGGAGAGAGAGTGGTGGAGGGG - Intergenic
1134780175 16:16888235-16888257 CTGGAGAGCTAGTGAGGGCCGGG + Intergenic
1134948376 16:18341018-18341040 CTGGAGAGAGAGTGGTGGAGGGG + Intergenic
1134955631 16:18381128-18381150 CTGGAGAGAGAGTGGTGGAGGGG + Intergenic
1134964193 16:18428420-18428442 CAAAAGAGAGAGTTGGGGCATGG - Intronic
1134968480 16:18510956-18510978 CAAAAGAGAGAGTTGGGGCATGG - Intronic
1135082666 16:19449812-19449834 CAGGAGAGAGAGTGGGTGCAGGG - Intronic
1135424361 16:22324969-22324991 CAGGAGCAAGAGCTGGGGCCTGG + Intronic
1135600793 16:23781851-23781873 CAGAAAACAGAGTTGGGGCCAGG - Intergenic
1135644813 16:24152587-24152609 TTCCAGAGAGAGCTGGGGCCGGG - Intronic
1136376864 16:29871086-29871108 CTGGAGAGAGGGCTGGGGAAAGG - Intergenic
1136860686 16:33700019-33700041 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1138124377 16:54426773-54426795 GTGGAGAGAGAAGTGGGGCAGGG + Intergenic
1138386632 16:56639769-56639791 CTGGGGACAGAGCTTGGGCCAGG + Intronic
1138608659 16:58105737-58105759 CTGCAGACAGAGGAGGGGCCAGG - Intergenic
1139378633 16:66516390-66516412 CCAGAGAGGCAGTTGGGGCCGGG + Intronic
1139488285 16:67271601-67271623 CTGGGGAGGGAGTTGGGGCAGGG - Exonic
1139831243 16:69800040-69800062 CTTAAGAGAGAGGTGGGGGCGGG + Intronic
1140212426 16:72981122-72981144 CTTTAGAGATAGCTGGGGCCCGG - Intronic
1140808484 16:78554849-78554871 CTGAAGACAGAGGTGGGACCTGG + Intronic
1141461382 16:84180407-84180429 CTGGAGAGCCACATGGGGCCTGG - Intronic
1141621074 16:85236720-85236742 CTGGAGAGAGAACTTTGGCCAGG - Intergenic
1141650935 16:85392826-85392848 CTGGAGAGGCGGCTGGGGCCAGG + Intergenic
1141805682 16:86340058-86340080 CTGGAGAGGGAGGTGGGGCCAGG - Intergenic
1141859528 16:86706930-86706952 ATGGAGAGACAGTCTGGGCCTGG + Intergenic
1141946115 16:87311097-87311119 CTGAAGAGTGAGGTGGGGGCCGG - Intronic
1142112237 16:88339127-88339149 CTGGAGCGAGAGTGGGAGCCAGG + Intergenic
1142157005 16:88537234-88537256 CAGGAGTGGGAGTTCGGGCCTGG + Intergenic
1203122185 16_KI270728v1_random:1548202-1548224 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1142628166 17:1205428-1205450 CTGGAGAGAGGAGTGGGGTCGGG + Intronic
1142851903 17:2708353-2708375 CCGGAGAGAGGGGTGGGGCAGGG + Intronic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143452268 17:7043108-7043130 TTGGAGAGAGTTTGGGGGCCCGG - Intronic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1144780137 17:17803934-17803956 CTGAAGAGTGAGATGGGGCCTGG - Intronic
1145746778 17:27325688-27325710 TTAAAGAGAGAGTCGGGGCCAGG + Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146214934 17:30971383-30971405 CTGGAGAGGGAACTGGAGCCCGG - Exonic
1146234629 17:31146735-31146757 CTGGAGCGAGAATGGGAGCCTGG + Intronic
1146370250 17:32261686-32261708 CTGCAGAGAGAGAAGGGGCTCGG + Intergenic
1146670135 17:34731646-34731668 GTGCAGAGAGACTTGGGGGCTGG + Intergenic
1146866316 17:36337903-36337925 CAGGAGAGCGAGTTGGACCCGGG - Intronic
1147069186 17:37938515-37938537 CAGGAGAGCGAGTTGGACCCGGG - Intergenic
1147080714 17:38018052-38018074 CAGGAGAGCGAGTTGGACCCGGG - Intronic
1147096657 17:38142012-38142034 CAGGAGAGCGAGTTGGACCCGGG - Intergenic
1147258435 17:39195561-39195583 CTGGGGAGGGAGTAGGGGCATGG + Intronic
1147610844 17:41801117-41801139 CTGGAGAGAAAGTAGGGGTGGGG + Intergenic
1148623933 17:49054677-49054699 CTGGAGTGAGACCTGGGGCTTGG + Exonic
1148755606 17:49971572-49971594 CTGCTGGGAGAGTTGGGGCGCGG + Intronic
1148856109 17:50580103-50580125 GTGGAGAGAGAGTGGGACCCTGG + Intronic
1149712413 17:58755756-58755778 CTGGAGGGAAAGTTGGTGGCGGG - Intergenic
1149795656 17:59516786-59516808 CTGGAGAGAAAGTGAGGGCCAGG + Intergenic
1151555737 17:74845886-74845908 CTGGAGAGAGACTTGAGGAAGGG - Intronic
1151567501 17:74907408-74907430 CTGGAGGGAGAGGTGCGGGCGGG - Intergenic
1151746310 17:76013693-76013715 GCGGAGAGAGAGTGGTGGCCTGG - Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1151962123 17:77411169-77411191 CTTGGGAGAGAGTTGGGGAATGG - Intronic
1152376014 17:79919400-79919422 CTGTAGAGAGAGGTGGTTCCTGG - Intergenic
1152598827 17:81251371-81251393 CTGGAAAGAGAAGGGGGGCCTGG + Intronic
1152705394 17:81841061-81841083 CTGGAGAGAACGTTGGGACATGG - Intergenic
1153643482 18:7174934-7174956 TTGGAGAGGGAGGTGGGGCCAGG - Intergenic
1153665018 18:7360665-7360687 GTGGAGGGAGAATTGGGGGCGGG + Intergenic
1154231186 18:12557510-12557532 ATGGAGAGAGAGGTGTGGGCGGG - Intronic
1155189214 18:23414375-23414397 AGAGAGAGAGAGTTGGGGCAGGG + Intronic
1155730017 18:29145038-29145060 CTGGAGAGAGAGCTCGTTCCTGG + Intergenic
1156355910 18:36339665-36339687 GTGCAGAGAGAGTTGGGGTTGGG + Intronic
1156575305 18:38308084-38308106 CTGGAGATAGTGTGGGTGCCAGG + Intergenic
1157463100 18:47919285-47919307 CTGGAGAGTGTGTTGGGGGTGGG - Intronic
1157686373 18:49645939-49645961 GTGGAGAGAGAGGAGTGGCCTGG - Intergenic
1158134949 18:54197926-54197948 CTGTAGATAAAGTTGGGGACAGG - Intronic
1158303198 18:56075810-56075832 CTGGAGAGAAATTTGGGTTCTGG + Intergenic
1159142150 18:64410295-64410317 CTAGTGAGAGATTTGGGGGCTGG - Intergenic
1160438715 18:78871987-78872009 CTGCAGAGAAAGGTGGGGGCTGG - Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160543735 18:79639265-79639287 CTGGTGAGGGAGTGGGGGGCTGG + Intergenic
1160929714 19:1564692-1564714 CTGGGGAGAGGGCTGGTGCCAGG + Intronic
1161230427 19:3172319-3172341 CTGGAGAGGGATGTGGGGCTCGG - Intergenic
1161346181 19:3769901-3769923 CTGGAGAGAGGGTGGGTCCCGGG - Exonic
1161436537 19:4267040-4267062 CTTGAGAAAGAGTTAGGGGCAGG - Intronic
1161449717 19:4338405-4338427 CGGGAGAGACAGACGGGGCCAGG + Intronic
1161800306 19:6413929-6413951 CAGGCGAGAGAGTGAGGGCCCGG + Exonic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162127376 19:8506690-8506712 CTGGAGAGGGGTTAGGGGCCTGG + Intergenic
1162558980 19:11405081-11405103 CGGGGGAGGGACTTGGGGCCAGG - Intronic
1162560954 19:11418192-11418214 CGGGAGAGGGAGTAGGGGACAGG - Intronic
1162833914 19:13303735-13303757 ATGGAGAGAGAGAAGGGGACAGG - Intronic
1163374774 19:16923274-16923296 CTGGACAGAAAGCTGGGGACGGG + Intronic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1163717366 19:18879976-18879998 CTGGTGAGATAGGTTGGGCCAGG - Intronic
1164700063 19:30278737-30278759 CTGGAGAGAGAGCAGTGGCAGGG - Intronic
1164809776 19:31147003-31147025 TTGCTGAGAGAATTGGGGCCGGG + Intergenic
1165075673 19:33278782-33278804 CTGGCCAGAGAGTTGGGCCCTGG + Intergenic
1165286496 19:34846972-34846994 CACGAGAGAGAGTGGGGGCGAGG - Intergenic
1165334612 19:35160639-35160661 GGGGAAAGAGAATTGGGGCCGGG - Intronic
1165476774 19:36035246-36035268 CTGATGAGAGACTTGGGCCCAGG + Exonic
1165570523 19:36771537-36771559 CTGAAGTGAAAGTTTGGGCCGGG + Intronic
1165750335 19:38255810-38255832 CTGGAGAAAGAGTGGGGGAAGGG - Intronic
1165825847 19:38705336-38705358 CTAGTGAGAGAGTTGGGCCTGGG + Intronic
1166305106 19:41932914-41932936 CTGGAGACAGATGTGGGGGCTGG + Intergenic
1166834496 19:45658993-45659015 CTGGCGAGAGATGTGGGTCCAGG - Intergenic
1167112002 19:47468139-47468161 CCAGAGAGGGAGTCGGGGCCAGG - Intronic
1167234152 19:48303634-48303656 CTGGAGAGTGAGTGGGGCCCTGG - Exonic
1167267919 19:48492806-48492828 CTGGAGAGAGAGTGTGGGTCTGG - Intronic
1167385416 19:49160193-49160215 ATGGAAAGCGATTTGGGGCCGGG + Intronic
1167513667 19:49910337-49910359 TCAGAGAGAGAGATGGGGCCGGG + Intronic
1167538438 19:50070353-50070375 CTGGGGAGAGTGTCAGGGCCAGG + Intergenic
1167784830 19:51628110-51628132 GGGGAAAGAGAGATGGGGCCAGG + Intronic
1168072616 19:53961338-53961360 GTGGAGAGACATTTGGGGTCTGG + Intergenic
925036563 2:691970-691992 CTGGAGAGAGATGCGGGGCGTGG - Intergenic
926052668 2:9754714-9754736 CTGGAGAGAGAGGGTGGGCAGGG + Intergenic
927397122 2:22665352-22665374 CTCGAGAGACAGTTGGGGGTAGG - Intergenic
927640303 2:24841526-24841548 CTGGAGAGCCAGGCGGGGCCAGG + Intronic
927685185 2:25165756-25165778 CTGGAGAGAGGGGTGGGTACAGG - Intronic
928082870 2:28326046-28326068 CTGGGGTGTGACTTGGGGCCTGG + Intronic
930087146 2:47505736-47505758 CTGGGGAGAGAGATGAAGCCGGG + Intronic
930103083 2:47617999-47618021 CGGGTGGGAGAGTTGGGGCTAGG + Intergenic
930293498 2:49525547-49525569 AGAGAGAGAGAGATGGGGCCTGG - Intergenic
930741396 2:54836130-54836152 CTGGAGACAGATTTGCAGCCAGG + Intronic
930875783 2:56214005-56214027 CTGGAGAGACATTGGGGACCAGG + Intronic
932571328 2:72940015-72940037 CTGGTGAGGAAGATGGGGCCTGG - Intergenic
932775242 2:74524601-74524623 ATTTAGAGTGAGTTGGGGCCAGG + Intronic
933022273 2:77208647-77208669 ATGGAGAGAGAGTTGAGTCAGGG + Intronic
933515929 2:83301768-83301790 GGGGAGAGAGAGTAGGGGCAAGG - Intergenic
934459066 2:94201172-94201194 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
934554749 2:95281394-95281416 CTGGGGAGAGAGGTGGGGGGCGG + Intronic
934574318 2:95390766-95390788 TGGGAAAGAGAGTTGGGGGCTGG + Intergenic
935217886 2:100988896-100988918 CTGGAGGAACAGTGGGGGCCTGG - Intronic
936235841 2:110741851-110741873 ATGGTGAGGGAGTTGGGGCAGGG + Intronic
937262803 2:120597163-120597185 CTGGAGGGTGAGGCGGGGCCCGG + Intergenic
937307158 2:120879324-120879346 CTGGAGAGTCAGTTGCAGCCAGG + Intronic
939475296 2:142678991-142679013 CTGTAGAGGGAGTTGGGGTGGGG + Intergenic
940725060 2:157327697-157327719 CAGTAGAGACAGTTGTGGCCAGG + Exonic
942304049 2:174588913-174588935 GGGGAGTGAGAGATGGGGCCAGG - Intronic
942797722 2:179841335-179841357 CTGGTGAGTGGGTTGGGACCTGG - Intronic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
943112571 2:183623955-183623977 CTGGAGAAATAGTTGGTTCCAGG + Intergenic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
944237453 2:197453318-197453340 CAGGAGAGAGAGGTGTGTCCTGG + Intergenic
946371859 2:219285964-219285986 CTGGGGAGAGAGCAGGGGCGGGG - Exonic
948579469 2:238974608-238974630 CTGGAGAGAGGGGTTGGGCTAGG - Intergenic
948659594 2:239498859-239498881 CTGCAAAGGGAGGTGGGGCCAGG + Intergenic
948908522 2:240991491-240991513 CTGAAGAGTGAGTGGTGGCCCGG - Intronic
948946684 2:241224074-241224096 CTGGGGAGAGGGTTGGGGGCAGG - Intronic
1168955657 20:1832584-1832606 CCGGAGAGGGAGCTGGGGCTCGG + Intergenic
1168964900 20:1893532-1893554 ATGGACAGAAAGTTGAGGCCCGG - Intergenic
1169141433 20:3229330-3229352 ATCGAGAGTGAGTTGGGGCCGGG - Exonic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1169592054 20:7155355-7155377 GTAGATAGAGAGATGGGGCCTGG + Intergenic
1169901758 20:10560235-10560257 CTGTAGACAGGGATGGGGCCAGG - Intronic
1170456682 20:16540297-16540319 CTGGAGAGTGAGTGGGAGCAGGG + Intronic
1170928199 20:20744943-20744965 CAAGAGAGAGAGGTGGTGCCAGG - Intergenic
1171095740 20:22331049-22331071 CTGAAGAGAGAGTGCTGGCCGGG - Intergenic
1171210137 20:23310475-23310497 CTGGAGGGAGAGTCCGGCCCAGG - Intergenic
1172170866 20:32931114-32931136 CCGCAGAGTGAGTTGGGGTCTGG + Intronic
1172776899 20:37413211-37413233 GTGGAGAGAGAGATGGATCCGGG - Intergenic
1172961601 20:38804456-38804478 CTGGAGAGGGCCTGGGGGCCTGG + Intergenic
1173023260 20:39285316-39285338 CTTGGGAAAGAGTTGGGGCATGG + Intergenic
1173029620 20:39342711-39342733 CTGGAGAGAGAAGAGGGGCAGGG + Intergenic
1173444866 20:43108555-43108577 CTCGAGACAGGGTTGGGGGCGGG + Intronic
1173803237 20:45908053-45908075 CTGGAGAGGGAATTTGGGCCTGG - Intronic
1173862142 20:46290897-46290919 CTGCAGAGAGAGTTGGCATCTGG + Intronic
1174282455 20:49449080-49449102 CTGGAGCCAGAGGTGAGGCCAGG - Intronic
1174421151 20:50399925-50399947 CAGGTGAGAGAGGTGGGGCTGGG - Intergenic
1174503996 20:51004996-51005018 CTGGAGAGAGAGATGAGGAGCGG - Intronic
1174943947 20:54964050-54964072 TTGGAGAGATAGGTAGGGCCAGG + Intergenic
1174972606 20:55293306-55293328 GTGGAGAGACAGTTTGGGCTGGG + Intergenic
1175385154 20:58590078-58590100 CTGGAGAGACACGTGAGGCCTGG + Intergenic
1175890892 20:62315467-62315489 CAGGAGAGATGGTGGGGGCCAGG - Intronic
1175895977 20:62335744-62335766 CTGGAGAGAGTGTTGGGGTACGG - Intronic
1175896028 20:62335918-62335940 CTGGAGGGAGTGTTGGGGTGTGG - Intronic
1175896045 20:62335974-62335996 CTGGAGGGAGTGTTGGGGTGTGG - Intronic
1176195688 20:63835579-63835601 CTGGAGCGGCAGTTGGGGCTTGG - Intergenic
1177612538 21:23470442-23470464 CTGGAGAGAGTTTAAGGGCCAGG - Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179535565 21:42049359-42049381 GTCGAGAGAGGCTTGGGGCCCGG - Intergenic
1179643328 21:42761022-42761044 GTGGAGGCAGAGTTGGGGGCTGG - Intronic
1180553007 22:16556074-16556096 CTGGAGAGAGCTTTGGGTCACGG + Intergenic
1180882863 22:19218839-19218861 CTGGGCAGAGTGCTGGGGCCAGG - Intronic
1180966343 22:19789682-19789704 CTGGGCCGAGCGTTGGGGCCAGG + Intronic
1181317503 22:21980201-21980223 CTGGAGTGGGTGTTAGGGCCTGG + Intronic
1181351082 22:22258365-22258387 CTGGAGAGAGCTTTGGGTCACGG - Intergenic
1181357150 22:22305297-22305319 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1181482805 22:23211816-23211838 CTGGAGGGTGAGATGTGGCCTGG - Intronic
1182043167 22:27254148-27254170 CAGAAGAGAGAGTTGGGGATTGG + Intergenic
1183248658 22:36712800-36712822 CTGGAAAGGGAGGCGGGGCCTGG + Intergenic
1183469358 22:37997407-37997429 CTGGAGAGAGACAGGGAGCCAGG - Intronic
1183493177 22:38127508-38127530 GGGGAGAGAGAGGTGGAGCCAGG + Intronic
1183597587 22:38821964-38821986 CTGGAGACTGAGGTGGGGCTGGG + Exonic
1183641747 22:39097041-39097063 CTGGAGAGGGAATTGGGGGTGGG + Intergenic
1183667671 22:39254794-39254816 CTGGAGAGAAAGCTGGGCCAAGG - Intergenic
1184147033 22:42617776-42617798 CTGGAGAGGGAGGCGGGGCTAGG - Intergenic
1184468933 22:44684668-44684690 CTGGGCAGAGAGCTGGGGGCGGG - Intronic
1184762421 22:46552039-46552061 CTGGGGAGAGAGCTGAGCCCAGG - Intergenic
949560381 3:5196159-5196181 TAGGAGATAGAATTGGGGCCGGG + Intronic
950581346 3:13864312-13864334 CTGGGGAAAGAGGTGGGACCAGG - Intronic
951097014 3:18644337-18644359 CTGGAGTAAGAGTTGGGAGCAGG - Intergenic
952881913 3:37990836-37990858 CTGGGCAGAGAGTTGGGGGGCGG + Intronic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953448354 3:42986611-42986633 CTGGAGATGGGGCTGGGGCCAGG + Intronic
953839107 3:46374514-46374536 CAGGCGAGAGACTTGTGGCCTGG + Exonic
954073210 3:48158220-48158242 CTGGTGAGAGCGTTGGACCCAGG - Exonic
954506619 3:51082161-51082183 CCAGAGAGAGAGTTTGGGCCGGG + Intronic
954582223 3:51709065-51709087 CTGGAGGGAGACTTGGTGCTGGG + Exonic
955045082 3:55352132-55352154 CTGGAGAGAGCCTCCGGGCCAGG - Intergenic
955275831 3:57546040-57546062 CTGAAGAGAAAGTTTGGCCCTGG - Intergenic
955971437 3:64442348-64442370 TGGGAGAGAGAGTTGGGCCTGGG - Intronic
956632567 3:71331128-71331150 GTGGAGAGAGAGGTGTGGGCGGG + Intronic
956837110 3:73104409-73104431 CAGGAGAGACATTTGGGGCTGGG - Intergenic
956870627 3:73413748-73413770 CAAGAGGGAGAGGTGGGGCCCGG + Intronic
957510110 3:81176932-81176954 CTAGAGAGAGATGTGGGGCAAGG - Intergenic
958059417 3:88460437-88460459 TTGGAGAGTGAGGTGGGGGCAGG - Intergenic
959710814 3:109384137-109384159 CTGGAGCAGAAGTTGGGGCCAGG + Intergenic
960055783 3:113275419-113275441 CTTGAGCGAGAGTGGCGGCCTGG - Intronic
960237219 3:115297753-115297775 GTGGAAAGAGAATTGGGGTCTGG + Intergenic
961563412 3:127746801-127746823 CTGGAGGGAGATTGGGGGCTGGG - Intronic
961828048 3:129608787-129608809 CTGGAGAGGGAGTGGGGGTGAGG - Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
961943793 3:130664320-130664342 CTGGAGACAGTGTTGGGTCACGG + Intronic
962877940 3:139550189-139550211 TTGGAGAGACAGGCGGGGCCAGG + Intergenic
962915262 3:139895632-139895654 CTGGAGGGAAAGTAGGGGCATGG - Intergenic
964528606 3:157643200-157643222 CTCGACAGAGAGATGAGGCCCGG - Intronic
964684019 3:159375297-159375319 CTGGAGTGAGAGGTGATGCCTGG + Intronic
965817872 3:172655513-172655535 AAGGAGAGAGAGTTGGGGAAAGG + Intronic
967943851 3:194786916-194786938 CAGTAGAGAGGGTGGGGGCCTGG + Intergenic
967988475 3:195113771-195113793 CAGGAGAAAGGGTTGTGGCCAGG + Intronic
968068952 3:195774114-195774136 CAGGAGAGAGAAGTGGGCCCTGG + Intronic
968647537 4:1748122-1748144 CTGGAGAGAGCATGGGGGCATGG - Intergenic
968648207 4:1750172-1750194 CTGCAGAGAGAGGAGGGGGCGGG + Intergenic
968726908 4:2252042-2252064 CTGGAAGGAGAGAGGGGGCCAGG - Intronic
969331194 4:6474218-6474240 GTGGACAGAGAGTGGGGGGCTGG - Intronic
969577486 4:8045103-8045125 GTGGAGAGAGAAGGGGGGCCCGG - Intronic
969666517 4:8560462-8560484 CTAGGGGGAGGGTTGGGGCCTGG + Intronic
969939858 4:10721176-10721198 CTGAGGAGGGAGTTGGGGGCTGG + Intergenic
970075228 4:12210803-12210825 CTGGAGTCAGAGTCGGGGCAGGG + Intergenic
970859362 4:20684028-20684050 CTGGAGAGAGACTTGGCATCCGG + Intergenic
972659982 4:41106843-41106865 CTGGAGAAATAGTTGGGTCTGGG + Intronic
972675478 4:41256500-41256522 CTGCTGAGAGATTTGGGGCGGGG + Intronic
973720824 4:53721617-53721639 CAGGTGAGAGAGTTGGGGATTGG + Intronic
974091505 4:57316026-57316048 CTGTAGAGGTAGATGGGGCCAGG + Intergenic
975355705 4:73400958-73400980 TTGGAGAGAAAATTGGGGACAGG - Intronic
977671373 4:99699234-99699256 CTGGAAAGAGGGTTGAAGCCAGG + Intergenic
978536780 4:109771009-109771031 CTGGAGAGAGAGTTAGGGGTGGG + Intronic
979896191 4:126160996-126161018 CTAAAGAGAGAATTGGGGCTGGG + Intergenic
981170282 4:141615504-141615526 GTGGAGGGAGAGGTGGGGGCGGG + Intergenic
981606564 4:146546594-146546616 CTGGAGAGTCAGTGGGGACCAGG - Intergenic
981722613 4:147816514-147816536 CTGGACTCAGAGTTAGGGCCAGG + Intronic
982409759 4:155061359-155061381 CAGGTGAGAGAGTTGGGGGAAGG + Intergenic
983504086 4:168533684-168533706 CTGGAGAGATAGCTGGGCCATGG + Intronic
983559144 4:169083922-169083944 CTGAAGAGAGTGTTGGGGGCTGG + Intergenic
983946703 4:173594110-173594132 CAGGAGAAAGAGTTGGGGGTGGG + Intergenic
984021860 4:174495141-174495163 CTGGAAGGAGGGGTGGGGCCAGG - Intronic
984812369 4:183806668-183806690 CTGGAGGGAAAGTGGGGGTCGGG - Intergenic
985089706 4:186350600-186350622 CTGGAGAGGGAGTGCGGGCCAGG - Intergenic
985197077 4:187443068-187443090 TTGAAAAGATAGTTGGGGCCGGG + Intergenic
985520618 5:372507-372529 CTGGACAGGGAGCTGGGCCCAGG - Intronic
985537719 5:474085-474107 CTGGAGAGAGAGAGCGCGCCAGG + Intronic
985573241 5:661951-661973 GTGGAGGGAGAGTGGGGGCGTGG + Exonic
985608553 5:872663-872685 CTGAAGAGAGGGTTGCAGCCAGG - Intronic
986055808 5:4135782-4135804 CTGGAGACAGTGTTGTGGCAGGG + Intergenic
986293127 5:6416324-6416346 CTGGAGGGAGAGTGGCAGCCAGG - Intergenic
986767874 5:10944286-10944308 CAGGCGAGAGAGTTTGGGCAGGG + Intergenic
987916448 5:24220883-24220905 CTGGAGTGAAAGTTTGGCCCAGG + Intergenic
988500094 5:31777097-31777119 GTGGAGGGAGAGGTGCGGCCAGG + Intronic
988682160 5:33494169-33494191 CAGGAGGGAGAGTGGAGGCCTGG + Intergenic
990439680 5:55832234-55832256 TTGGAGGCAGAGGTGGGGCCTGG + Intergenic
990508548 5:56468947-56468969 CTGGAGTGAGAGTTGGGAATGGG - Intronic
990885316 5:60584999-60585021 CTGAAAAGAGAGGTGGGGTCTGG + Intergenic
993534609 5:89067129-89067151 CTAGAGAGGGACTTGGGGTCTGG + Intergenic
994745809 5:103676922-103676944 CTGGAGGGAGAGTGGGGGCTTGG + Intergenic
995324733 5:110877201-110877223 CTGGAAAGGGTATTGGGGCCTGG - Intergenic
996289535 5:121835450-121835472 CTGAAGACAGAATTCGGGCCAGG - Intergenic
996618556 5:125471660-125471682 CTGGTGAGGGAGTTGGGGAAAGG - Intergenic
997393230 5:133533846-133533868 CTGGAGAGAGAAGTTGGGGCAGG - Intronic
997529723 5:134574480-134574502 ATGGAGAGAGATTTTGAGCCAGG + Intronic
997893963 5:137699353-137699375 CTGGAGAGGTAGATGGGGCCAGG + Intronic
998179386 5:139925862-139925884 GTGGGTAGAGAGGTGGGGCCTGG - Intronic
998231184 5:140362296-140362318 CTGGGGAGAGAGTAGTGGTCAGG + Intronic
998591974 5:143487915-143487937 ATAAAGAGAGAGATGGGGCCAGG - Intergenic
999717313 5:154371666-154371688 CAGCTGAGAGAGTTGGGGCAAGG + Intronic
1001644365 5:173269242-173269264 CTGGACACAGACTTGGGGGCGGG + Intergenic
1001718834 5:173840014-173840036 CTGGAGAGTGGGTTGGGGTGGGG + Intergenic
1002106372 5:176881260-176881282 CTGGGGAGGGAGGTGTGGCCAGG - Intronic
1002194427 5:177494552-177494574 CTGGAGAGGGGGTGGGGGGCGGG + Intronic
1004579981 6:16940681-16940703 CTGGAAATAGATTTGAGGCCTGG - Intergenic
1005349419 6:24919532-24919554 CAGGAGTGAGAGTTGGGGGATGG + Intronic
1005353605 6:24960888-24960910 CTGGGGAGAGTCTTGGGGGCTGG - Intronic
1005452936 6:25991915-25991937 CTGGAGAGGGAGGTGGGGGTGGG - Intergenic
1005585080 6:27268561-27268583 CTTGATTGTGAGTTGGGGCCTGG - Intergenic
1005746174 6:28839477-28839499 GTGGCGAGAGAGTTCGGGTCCGG + Intergenic
1005892378 6:30150531-30150553 TGGGACAGAGAGTTGGGGGCTGG + Intergenic
1006374673 6:33665310-33665332 CTGGGGAGAGAGTAGGGGACTGG + Intronic
1006679709 6:35788155-35788177 CTGCCCACAGAGTTGGGGCCTGG + Intronic
1006689590 6:35870376-35870398 ATGGAGAAAGAGTCGGGCCCTGG - Exonic
1006935911 6:37717521-37717543 CTAAAGAGAGAGTTGGGCTCTGG - Intergenic
1007041288 6:38724864-38724886 CTGGTGAGAGAGTTGGGGTGAGG + Intronic
1007091211 6:39185934-39185956 CTGAAGAGAGAGGTGGGGCGGGG + Intergenic
1007632252 6:43279012-43279034 CTGGAAAGAGTTTTGGGTCCTGG + Intronic
1007763805 6:44149695-44149717 CTGGGGTGAGGGTGGGGGCCAGG - Intronic
1008547475 6:52595989-52596011 CTGAACAGAGAGTTGGGGGATGG - Intergenic
1009451663 6:63808180-63808202 CTGGACTGAAAGTTGAGGCCTGG + Intronic
1010211182 6:73363736-73363758 CTGGAGAGACTGCTGGGTCCCGG - Exonic
1010873742 6:81074824-81074846 CTTGAGAGAGAGCTGGGACTGGG + Intergenic
1011139245 6:84134334-84134356 CTGGAAAGAGGGTTGAAGCCAGG - Intronic
1011649430 6:89492180-89492202 CTGGAGAGAGCGCCGGGGCTGGG + Intronic
1011661660 6:89599958-89599980 CTGGAGGGGGAGCTGTGGCCTGG + Intronic
1012491655 6:99788962-99788984 CTGGAGAGAGTGGTGGTGGCGGG - Intergenic
1013225792 6:108118649-108118671 CTGGAGAGAGGGGTGGGGGCGGG - Intronic
1014612979 6:123567622-123567644 CAAGAGAGAGAGTGGGGGGCGGG + Intronic
1016037168 6:139395414-139395436 CTCCAGAGGGAGTTGGGGGCTGG + Intergenic
1016878207 6:148884587-148884609 ATGGAGGGGGAGGTGGGGCCTGG + Intronic
1017377350 6:153786645-153786667 CTGAAGGGAGAGTGGTGGCCAGG + Intergenic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1018361609 6:163076402-163076424 TTGGAGAGAGAGTTCTGGGCTGG - Intronic
1018386564 6:163309731-163309753 CAGGAGAGCGTGTTGGGGCCGGG + Intronic
1018701562 6:166431369-166431391 CTGCAGACTGAGGTGGGGCCTGG + Intronic
1018953750 6:168394592-168394614 ATGGAGAGAGAGATGGGGGAAGG + Intergenic
1019165228 6:170094107-170094129 CTGCAGAGAGGCCTGGGGCCAGG - Intergenic
1019306646 7:338619-338641 CTGGACAGAGCTGTGGGGCCAGG + Intergenic
1019467039 7:1195616-1195638 CTGTAAAGTGATTTGGGGCCAGG + Intergenic
1019924011 7:4180501-4180523 CTGGACATAGAGCTGGAGCCAGG - Intronic
1021567922 7:22032689-22032711 CTGGAGAGAGAGGTGCCGGCGGG - Intergenic
1021982983 7:26072763-26072785 CTGTGGAGAGAGTTGAGACCAGG + Intergenic
1022474546 7:30701387-30701409 CAGGAGAGGGAGGTGGGACCTGG - Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023156279 7:37255868-37255890 CTGGTGAGAGAGTGGGGCCTGGG - Intronic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1024924476 7:54598760-54598782 CTGCAGAGAGGGCTGGAGCCTGG - Intergenic
1024966217 7:55024149-55024171 CAGGAGGGGTAGTTGGGGCCAGG + Intronic
1026271537 7:68841410-68841432 AGGGAGAGAGAGTGGGGGTCCGG - Intergenic
1026970858 7:74466658-74466680 CTGGAGAGGGAGATGAGGTCAGG - Intronic
1028243900 7:88452911-88452933 CTGCAGGGAGAGTTGGTGCTGGG + Intergenic
1028404287 7:90459476-90459498 TTTAAGAGACAGTTGGGGCCAGG + Intronic
1028418126 7:90601588-90601610 CTGGACAAAGAGGTGGGGTCTGG - Intronic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1029095557 7:98082509-98082531 CTGGCCAGAGAGCTGGGGTCCGG - Intergenic
1029570072 7:101363265-101363287 CTGGAGCGAGGCTTGGGGGCTGG + Intronic
1029604257 7:101589159-101589181 CTGGAGAGAGAGCATGGGCTGGG + Intergenic
1030395964 7:108987223-108987245 CTAGAGAGATAGTTGTGGTCTGG + Intergenic
1030516548 7:110545300-110545322 CAGGAGAGAGAGATGGGGAGGGG - Intergenic
1030682513 7:112448996-112449018 CTGGAAAGGGAGTCAGGGCCAGG + Intronic
1031010916 7:116525179-116525201 GTGGAGAGAGGGCTGGGGCCAGG - Intronic
1031356595 7:120794473-120794495 CCGGAGAGAGAGATGGGGGGTGG - Intronic
1031423763 7:121581177-121581199 CTAAAGAGTGAGTAGGGGCCAGG - Intergenic
1031482966 7:122300418-122300440 CTGGAGGGAGAGAGTGGGCCGGG + Intergenic
1032012619 7:128356824-128356846 GTGGGGAGAGGGATGGGGCCAGG - Intronic
1032165441 7:129541348-129541370 CTGGAGAAAGGGCTGTGGCCTGG + Intergenic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1033618381 7:143039151-143039173 CTGAACAGAAACTTGGGGCCTGG - Intergenic
1034259835 7:149748106-149748128 CTGCAAAGAGAGCTGGGGGCGGG + Intergenic
1034405092 7:150897613-150897635 CTGGAGTGAGAGGTGGGCCCGGG - Intergenic
1034438613 7:151075571-151075593 CAGGAGAAAGAGTTGGCCCCGGG - Intronic
1034967582 7:155400729-155400751 CTGCAGAGGGAGTGGGGGACAGG - Intergenic
1034984730 7:155502213-155502235 ATGGAAAAAGAGTTGGGACCTGG - Exonic
1036609990 8:10341341-10341363 AGGGAGAGAGAGTTGGGGGGAGG + Intronic
1036630963 8:10514749-10514771 GTGGCGAGGGAGTTGGGGTCAGG - Intergenic
1037856434 8:22374500-22374522 CGGGAGAGAGAGCAGGGTCCTGG + Intronic
1039357873 8:36841240-36841262 CCTGAGAGAGAGGTGGGGCAGGG - Intronic
1039424929 8:37477778-37477800 CTGGAGAGAGGGTAGGGGTCTGG - Intergenic
1039911272 8:41828816-41828838 CTGGGGAGAGAGTTGGGCCTGGG + Intronic
1039976785 8:42373429-42373451 TTGGAGAGAGAGATGTGGCTCGG + Intergenic
1041009837 8:53530877-53530899 CTGAAGAGAGAGTGGAGCCCAGG - Intergenic
1041332007 8:56736856-56736878 CTAGAGAGTGACTTGAGGCCAGG - Intergenic
1042417080 8:68533043-68533065 CTTGAGAGAGCATTGCGGCCAGG - Exonic
1043195832 8:77290225-77290247 CTGGAGAGAAAGTAGGCTCCTGG - Intergenic
1045640803 8:104248216-104248238 CTGGAGAGGGAAATGGGGTCAGG + Intronic
1045901249 8:107282942-107282964 CGGGACAGAGTGTTGGGGCAGGG - Intronic
1046564199 8:115877896-115877918 ATGGAGAGAGAGTGGGGGAAAGG + Intergenic
1046809353 8:118515873-118515895 CTGCAGAGAGGGCTGGGGACTGG - Intronic
1047447180 8:124929995-124930017 CTGGAAAGACAGTTGGGCTCTGG - Intergenic
1049007251 8:139863393-139863415 CTGGAGAGCATGTAGGGGCCAGG - Intronic
1049343439 8:142126119-142126141 ATAGAGAGAGACTGGGGGCCCGG + Intergenic
1049468374 8:142764102-142764124 CTAGAGTGGGAGTTGGGGCTGGG - Intergenic
1049612628 8:143562519-143562541 CTGGTGAGAGGGTTGGGTTCGGG + Exonic
1049622725 8:143605883-143605905 CTGAGGAGAGCGTTAGGGCCTGG + Intronic
1051080051 9:13283358-13283380 CAGGAGAAAGCATTGGGGCCAGG + Intergenic
1051867450 9:21697108-21697130 CGGGCGAGAGAGTGAGGGCCCGG - Intergenic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1053481884 9:38422168-38422190 CTGGACAGGGTGTTGGGACCAGG + Intronic
1053689559 9:40576961-40576983 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1053793000 9:41699925-41699947 CTGGGGATGGGGTTGGGGCCGGG - Intergenic
1054152175 9:61614899-61614921 CTGGGGATGGGGTTGGGGCCGGG + Intergenic
1054274471 9:63054096-63054118 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1054300805 9:63377900-63377922 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054400353 9:64710833-64710855 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054433944 9:65195091-65195113 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054471949 9:65546043-65546065 CTGGGGATGGGGTTGGGGCCGGG + Intergenic
1054496443 9:65826579-65826601 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1055121903 9:72669950-72669972 CTGGAGAGAGATTCCAGGCCAGG + Intronic
1055669502 9:78588678-78588700 CTGGTGAGAGGTTGGGGGCCAGG + Intergenic
1056546072 9:87614946-87614968 CTGGAGTGAGGGTTGGAGACAGG + Intronic
1056638762 9:88352383-88352405 CTGGAGTGGGTGTTGGGGGCAGG + Intergenic
1057220905 9:93257260-93257282 CTGGCCAGGGAGTTGGGGCTGGG + Intronic
1058761126 9:108133403-108133425 CTGCAGAGAGAGTTGAGGGGTGG - Intergenic
1058871018 9:109201786-109201808 CTGGAGGGAAAGTCGAGGCCGGG + Intronic
1059151331 9:111952262-111952284 CTGAAGTGAGAGTTGAGCCCAGG + Intergenic
1059440235 9:114302429-114302451 ATCCAAAGAGAGTTGGGGCCGGG + Intronic
1059661178 9:116402387-116402409 ATGGAGAGAGCCCTGGGGCCTGG + Intergenic
1060550438 9:124482455-124482477 CAGGAGAGAGAGCTGGGAGCAGG + Exonic
1061181469 9:129027510-129027532 ATGGAGAGAGGGCTGGGGTCTGG - Intronic
1061282267 9:129604279-129604301 CTGGAGGGTGGGGTGGGGCCAGG - Intergenic
1061365075 9:130168459-130168481 CAGGAGAGACATTTGGGGGCTGG - Intergenic
1061365082 9:130168486-130168508 CAGGAGAGACATTTGGGGGCTGG - Intergenic
1061486334 9:130922329-130922351 CTGGAGAGAGACTGGGAGGCCGG - Intronic
1061888635 9:133606071-133606093 CTGGAGAGTCAGGTGGGGTCCGG - Intergenic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1062187170 9:135224278-135224300 CTGGACAGGTAGCTGGGGCCTGG - Intergenic
1062187190 9:135224340-135224362 CTGGACAGGTAGCTGGGGCCTGG - Intergenic
1062187211 9:135224402-135224424 CTGGACAGGTAGCTGGGGCCTGG - Intergenic
1062187230 9:135224463-135224485 CTGGACAGGTAGCTGGGGCCTGG - Intergenic
1062187251 9:135224525-135224547 CTGGACAGGTAGCTGGGGCCTGG - Intergenic
1062201835 9:135307070-135307092 CTGAACTGAGAGTTGGGGTCTGG - Intergenic
1062488013 9:136790914-136790936 CAGGGGAGAGGGGTGGGGCCTGG - Intergenic
1185765932 X:2725906-2725928 ATGGAAAGAGAGCTGGGGCTGGG - Intronic
1186021151 X:5256858-5256880 CAAGAGAGAAAGTTGGGGGCGGG + Intergenic
1186134955 X:6509540-6509562 TTGGAGAGAGTGTAGGTGCCAGG - Intergenic
1186196780 X:7116904-7116926 CCAGAGAGAGAGTTGGGGGGAGG - Intronic
1187281213 X:17860104-17860126 ATGGAGAGAGGGATGGGGCACGG - Intronic
1187303999 X:18078574-18078596 CTGGAGAGAGAGCAGAGGACTGG - Intergenic
1187836370 X:23436040-23436062 AGGGAGAGAGAGTTGGGGGGAGG - Intergenic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1189224214 X:39398910-39398932 CTGGGGAGAGAGTGGGGGGTGGG + Intergenic
1189379388 X:40491056-40491078 CTGGAGGGAGACTTGGGGAAAGG + Intergenic
1190789516 X:53686218-53686240 CTAAAGAGAGAGTAGAGGCCGGG - Intronic
1191736625 X:64394851-64394873 CTGGAGCGAGAGTGGGGTTCTGG + Intronic
1191901011 X:66040495-66040517 CTGGACAGGGTGTTGGGCCCGGG + Intergenic
1191969651 X:66799195-66799217 CTGGAAAGAGGGTTGAAGCCAGG + Intergenic
1192633100 X:72792022-72792044 GTGGAGAGAGAGTTAGGCACGGG - Intronic
1192648609 X:72928779-72928801 GTGGAGAGAGAGTTAGGCACGGG + Intronic
1192746108 X:73940588-73940610 TAGAAGTGAGAGTTGGGGCCGGG - Intergenic
1195745800 X:108116733-108116755 CTGGAGAGGAAGGTGGAGCCAGG - Intronic
1195910505 X:109884303-109884325 TTGGATAGAGAGTAGAGGCCTGG + Intergenic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1198082214 X:133250826-133250848 CTGGAGAGGGTGTGGGGGCAGGG + Intergenic
1198411320 X:136372353-136372375 CTGGTGAGAGAAATGGGGCTAGG - Intronic
1199486779 X:148357080-148357102 ATGGAGAGAGAACTGGGTCCAGG + Intergenic
1200972466 Y:9167909-9167931 CTGGTGAGAGAGCTTGGGCTTGG + Intergenic
1201618209 Y:15925241-15925263 CTGGAGAGAGTGTAGGTGCGAGG - Intergenic
1201922455 Y:19248356-19248378 ATGGACAGAGAGTGAGGGCCAGG + Intergenic
1201949748 Y:19550653-19550675 GTGGAGAGTGGGGTGGGGCCTGG - Intergenic
1202579589 Y:26365858-26365880 CAGTAGAGATAGATGGGGCCTGG + Intergenic