ID: 1073110722

View in Genome Browser
Species Human (GRCh38)
Location 10:101061679-101061701
Sequence CTGTAAAATCAGATGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 242}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073110705_1073110722 30 Left 1073110705 10:101061626-101061648 CCAGAGCTCCTGCCGCCTCCCCC 0: 1
1: 0
2: 6
3: 85
4: 820
Right 1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 242
1073110716_1073110722 -5 Left 1073110716 10:101061661-101061683 CCTCGCCGACGCCAGGGACTGTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 242
1073110706_1073110722 22 Left 1073110706 10:101061634-101061656 CCTGCCGCCTCCCCCTTATGCAG 0: 1
1: 0
2: 0
3: 19
4: 218
Right 1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 242
1073110712_1073110722 9 Left 1073110712 10:101061647-101061669 CCTTATGCAGCTGCCCTCGCCGA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 242
1073110715_1073110722 -4 Left 1073110715 10:101061660-101061682 CCCTCGCCGACGCCAGGGACTGT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 242
1073110709_1073110722 12 Left 1073110709 10:101061644-101061666 CCCCCTTATGCAGCTGCCCTCGC 0: 1
1: 0
2: 1
3: 6
4: 142
Right 1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 242
1073110717_1073110722 -10 Left 1073110717 10:101061666-101061688 CCGACGCCAGGGACTGTAAAATC 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 242
1073110711_1073110722 10 Left 1073110711 10:101061646-101061668 CCCTTATGCAGCTGCCCTCGCCG 0: 1
1: 0
2: 0
3: 0
4: 56
Right 1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 242
1073110708_1073110722 15 Left 1073110708 10:101061641-101061663 CCTCCCCCTTATGCAGCTGCCCT 0: 1
1: 0
2: 0
3: 21
4: 241
Right 1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 242
1073110710_1073110722 11 Left 1073110710 10:101061645-101061667 CCCCTTATGCAGCTGCCCTCGCC 0: 1
1: 0
2: 2
3: 16
4: 158
Right 1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 242
1073110707_1073110722 18 Left 1073110707 10:101061638-101061660 CCGCCTCCCCCTTATGCAGCTGC 0: 1
1: 0
2: 2
3: 35
4: 405
Right 1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG 0: 1
1: 0
2: 0
3: 21
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073110722 Original CRISPR CTGTAAAATCAGATGGGACA GGG Intergenic
905930860 1:41786418-41786440 CTGTAAAATCAGAAGTGATGAGG - Intronic
906271908 1:44485980-44486002 CTGTAAAACCTGATAGGAGAGGG + Intronic
906727270 1:48053198-48053220 CTGTAAAATTATCTGAGACATGG - Intergenic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
908923927 1:69230380-69230402 CTGTGAACTCAGATGAGTCAAGG - Intergenic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
910726991 1:90349791-90349813 CTGTGAAAGCAGATGGGAAGGGG + Intergenic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
912143825 1:106766564-106766586 CTGTGAACTCAGATGTGACTAGG + Intergenic
914756122 1:150562430-150562452 CTCTAAAATAAGAGGGGAAAGGG - Intergenic
916243829 1:162666629-162666651 ATGTAAAATCATCTGGCACATGG + Intronic
916598718 1:166271882-166271904 CTGTAACCTCAGATGGCAGAAGG + Intergenic
917050391 1:170915925-170915947 CTGTTAAACCAGATGGGTAATGG - Intergenic
917489212 1:175483390-175483412 CTGTAAGAGCAGGTGGGGCAGGG + Intronic
918163956 1:181926623-181926645 CAGAAACATTAGATGGGACAAGG - Intergenic
918451770 1:184665375-184665397 CTGTAAAATGAGATAACACATGG - Intergenic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
920934357 1:210417523-210417545 ATGTAAAATAAGGTGGGGCATGG - Intronic
921329499 1:214021406-214021428 CTGTAAAATCAGAAAGGAAATGG - Intronic
924596213 1:245447181-245447203 ATGTTAATTCAGATGGGCCACGG - Intronic
924918034 1:248594136-248594158 CTGTAAAATCCCATGGGAATGGG - Intergenic
1063172170 10:3518585-3518607 CTTTAAAAAAAGATGGGACAGGG - Intergenic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1067715726 10:48689962-48689984 CTTTAAAATCAGGTGGAACTAGG - Intronic
1067728484 10:48791612-48791634 TGGTAAAGTCAGATGAGACATGG + Intronic
1069118406 10:64536662-64536684 CTGCAAAATCAAAGGGGAAAAGG - Intergenic
1069322073 10:67184346-67184368 ATGTAAAAGGAGATGGAACATGG - Intronic
1070758217 10:79006551-79006573 GCCTAAAATCAGAAGGGACATGG + Intergenic
1071710905 10:88048199-88048221 ATGTAAAATCAGAGGAGACAGGG - Intergenic
1071960098 10:90801788-90801810 CTGTTCAATCAGATTGCACAAGG - Intronic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1074094413 10:110297247-110297269 ATATAAACTCAGTTGGGACAAGG + Intronic
1074910169 10:117901192-117901214 CTGTAAAGTCAGTGGGGGCAGGG - Intergenic
1076364418 10:129912634-129912656 CTGTGAAATCAGTTGGGAACAGG - Intronic
1080984553 11:37445902-37445924 GTGAAAAATCTGCTGGGACAAGG + Intergenic
1086274689 11:85112087-85112109 CTGTAAGATCACATGAGTCAAGG + Intronic
1092986360 12:13849733-13849755 CTTTGAAATCAGATGGGAACAGG - Intronic
1093254830 12:16854209-16854231 CTGTAAAATATGATGTGAGAAGG + Intergenic
1097240430 12:57571461-57571483 TTTTAAAATCAGATGGAAGAAGG + Intronic
1097531367 12:60804550-60804572 CAATAAAATAAGATGGGGCAAGG - Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1098539891 12:71642742-71642764 CTGTATAATCAGATAGAAAATGG + Intronic
1100122628 12:91386411-91386433 GAGTAAAATCAGGTGGGGCATGG + Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1100923924 12:99522284-99522306 CTGTAAATTTAGGTGGCACAGGG - Intronic
1101858107 12:108461012-108461034 AAGAAAAATCAGATGAGACATGG + Intergenic
1101940844 12:109098064-109098086 CTGTCCAATCAGAGGGGAGAGGG + Intronic
1102743932 12:115233151-115233173 TTCTAAAAACAGATGGTACAGGG + Intergenic
1103190741 12:118999756-118999778 CTCTGGAATCAGATGGGACTGGG - Intronic
1103738240 12:123074222-123074244 CTGTTAAATCAGATGAGACTTGG + Intronic
1104280524 12:127372469-127372491 CTGGAAAAACACATGGGACTTGG - Intergenic
1106101641 13:26698520-26698542 CTGAAAAATCAGCTGGCAAAAGG - Intergenic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1107824286 13:44313482-44313504 CTGTAAAATCAAATAAAACATGG + Intergenic
1109077258 13:57852346-57852368 TTTTAAAATCATATGGGAAATGG + Intergenic
1110379994 13:74839370-74839392 CTGTAAGATCACATGGCAAAAGG + Intergenic
1110683369 13:78342859-78342881 GTGTAAAATGAGTTGGGAGAAGG - Intergenic
1112190125 13:97168866-97168888 CTGAGAGATCAGATGAGACAAGG - Intergenic
1112674346 13:101681381-101681403 CTGTAAACTCAGAAGCCACAGGG - Intronic
1113714269 13:112492165-112492187 TTCTAAAATCAGATGGCAAAAGG - Intronic
1114305734 14:21421080-21421102 CTGAAAAATCAAATGGCAAATGG + Intronic
1115738348 14:36359889-36359911 CTGAAAAATCACATGGCAAAGGG - Intergenic
1118840037 14:69502979-69503001 CTAGAAGATCAGATGGGGCAGGG + Intronic
1119147825 14:72332691-72332713 CTGAAAAGTGAGATGAGACAAGG - Intronic
1119670302 14:76513415-76513437 CTGCAAAAGCAGATTGGACAGGG + Intergenic
1120318410 14:82927647-82927669 ATGTAAAAACAGGAGGGACATGG - Intergenic
1123796733 15:23780195-23780217 CTTTAAAATCTGATGGGGTAAGG + Intergenic
1123889995 15:24768145-24768167 CTGAAAAATCAGCTGGCAAAAGG + Intergenic
1124871724 15:33550169-33550191 CAGTAACATCAGATGGGGCCAGG + Exonic
1127408682 15:58682315-58682337 CTGTAAAATGGGATGGGAAGGGG + Intronic
1129232501 15:74204522-74204544 ATTTAAAATCAGATGGGAGTTGG - Intronic
1129375907 15:75131458-75131480 CTGTAAAACCAGAAGTGAGATGG + Intergenic
1129628972 15:77236249-77236271 CTGTGAAAGCAGCTGGGACGGGG + Intronic
1130662465 15:85841430-85841452 CTGAAAAATAAGATGGGGCCAGG - Intergenic
1131154432 15:90066019-90066041 CTTTCAAATCAGATCGGACATGG + Intronic
1133638244 16:7690929-7690951 CTGTAAAATCAGATTGGCTTTGG - Intronic
1135180401 16:20268612-20268634 CTGCAAAGTAAGAGGGGACAAGG + Intergenic
1136000502 16:27288840-27288862 CTGGGAAATCGGATTGGACAGGG + Exonic
1137002540 16:35242181-35242203 CTAGAAAAGCTGATGGGACAGGG + Intergenic
1137016442 16:35380346-35380368 CTAGAAAAGCTGATGGGACAGGG + Intergenic
1138715705 16:59019634-59019656 CTGAAAAATCAGTTAGGATATGG + Intergenic
1139330045 16:66181113-66181135 CTCTGAGATCAGATGGGACTAGG - Intergenic
1139332623 16:66205325-66205347 CTGTGAGTTCGGATGGGACAAGG + Intergenic
1140578614 16:76202368-76202390 ATGTATGATCAGATGGAACAGGG + Intergenic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1144281815 17:13734039-13734061 CTGTAAAAGCAGCTGGGAGTGGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1148520294 17:48267875-48267897 CTGTATAATCACATGAGAAATGG - Intronic
1148804764 17:50258649-50258671 CTGTAAAATGGGATGGGGCCAGG - Intergenic
1148814568 17:50318224-50318246 CTGTGAAATCAGATGGCTCTGGG + Intergenic
1149447367 17:56724063-56724085 CTGTAAAGTCACATGGAAAAAGG + Intergenic
1153771505 18:8420602-8420624 CTGTAAAAGGAGAAGAGACACGG - Intergenic
1155299844 18:24419214-24419236 CTGAAAAATCAACTGGCACAAGG - Intergenic
1155608040 18:27630500-27630522 CTGTAAAAACTGATAGGAAAAGG - Intergenic
1155898655 18:31360973-31360995 CTTTGAAGTCTGATGGGACATGG - Intergenic
1156724495 18:40111794-40111816 ATTTAGAATCAGATGGGAGATGG - Intergenic
1156890613 18:42185940-42185962 ATGTCAAATCACATGGGAAATGG + Intergenic
1161267085 19:3369419-3369441 TTGTAAAATTAGCTGGGAAAAGG - Intronic
1163677962 19:18664877-18664899 CTCTAAAATCAGAAGGGGCCCGG - Intronic
1164651734 19:29895609-29895631 CTTAAAAATCAGAGGGGACACGG + Intergenic
1165679925 19:37765383-37765405 TTGTCATATCAGATGGGAGAAGG + Intronic
1167414583 19:49363351-49363373 CGGGAAAACCAGAAGGGACACGG + Intronic
1167449659 19:49559780-49559802 CTGTATTCTCACATGGGACATGG - Intronic
1167857833 19:52256919-52256941 CTGTAAAATCTGGTCGGGCACGG - Intergenic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
925802879 2:7618709-7618731 GTGTGAACTCTGATGGGACATGG + Intergenic
926756789 2:16242979-16243001 CTGTAAAGCCAGAAGAGACAGGG - Intergenic
927001828 2:18803560-18803582 CTGTAAAATAAGATAGAAGAAGG - Intergenic
928972328 2:37043223-37043245 CTGTAACAGGAGATGGAACATGG + Intronic
929234616 2:39592943-39592965 CTGTAAAGTCCTATTGGACAGGG + Intergenic
929438784 2:41949172-41949194 CTGTTAAACCAGAAGAGACAGGG + Intronic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
931543351 2:63353816-63353838 CTGGAAAATCCGAAGTGACAAGG + Intronic
931792499 2:65676998-65677020 TCCTAAAAGCAGATGGGACAGGG - Intergenic
931975588 2:67640562-67640584 CTAGAAAATGAGATTGGACAAGG + Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932629703 2:73329186-73329208 CTGTCAAATCAAACGGGAGAAGG - Intergenic
933085160 2:78046391-78046413 CTGTAAAAGCAGCTGGGAGTGGG + Intergenic
933779018 2:85788615-85788637 CTGTCAAGGCAGAAGGGACAGGG + Intergenic
936082771 2:109446242-109446264 CTGTGAAATCGGAAGTGACATGG + Intronic
936466659 2:112758106-112758128 TTGTAAAATCAGCCAGGACAGGG + Intronic
936666649 2:114604465-114604487 CTGTACACGCAGATGGGTCAGGG - Intronic
937007678 2:118532323-118532345 GTTTAGAATCTGATGGGACAAGG - Intergenic
938142662 2:128809415-128809437 TTGCAAAATCACATGGGATAAGG - Intergenic
938366692 2:130740143-130740165 CTGTAAAATGAGAAGCGATATGG - Intergenic
941036635 2:160575971-160575993 CTGGTATATCAGATGGGAAAGGG - Intergenic
941722922 2:168831227-168831249 CTGTAACCTCAGATGGCAGAAGG + Intronic
942605864 2:177690008-177690030 ATGTACAAGCAGATAGGACACGG - Intronic
944940545 2:204620481-204620503 CTTTAACATCAGAGGGGACAGGG + Intronic
1172629015 20:36365965-36365987 CTGTAAAATTGGAGGGGAGAGGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1178265311 21:31137634-31137656 CTGGAAAATCACATGGCAGAAGG - Intronic
1178438686 21:32581354-32581376 CTGAAAAATCAGATCACACATGG - Intronic
1179116257 21:38495432-38495454 CTTAAAAATCAGACAGGACATGG - Intronic
1182114614 22:27748913-27748935 CTGCAGAATCAGAGGGGTCATGG + Exonic
1183305162 22:37079101-37079123 CAGAAAACTCAGATGGGCCAAGG - Intronic
1184918942 22:47592114-47592136 CTGAAAACTCAGATGGGTCGAGG - Intergenic
949106769 3:208904-208926 CTAAAATATCAGATGGTACAGGG + Intronic
949216669 3:1578044-1578066 CTATAAAATCAGATTTGCCAGGG + Intergenic
949942192 3:9163575-9163597 CTGTCAAAGCAGAGGGGGCAGGG + Intronic
950598566 3:14009277-14009299 CTGTAATAGGAGATGGAACACGG - Intronic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
952034296 3:29180773-29180795 AGGTACAATCAGAAGGGACAAGG + Intergenic
952736394 3:36695603-36695625 CTGGAAAATCACGTGGGAAAGGG - Intergenic
956404067 3:68909681-68909703 CTCTACTATCAGATGGGACTGGG + Intronic
958114900 3:89203007-89203029 GTGAAAAACCAGATGGGATAAGG + Intronic
958950559 3:100411235-100411257 TTCTAAAATATGATGGGACAAGG - Intronic
959093311 3:101926950-101926972 CTGTGAAATAAGATTGGTCAAGG + Intergenic
960604252 3:119488680-119488702 CTTTAAAATCAGACGGGCCCTGG + Intronic
961574604 3:127824040-127824062 GTGTAAAAGCAGATGGTGCATGG + Intergenic
963351472 3:144157352-144157374 CTGTAAAATGAGATGTTAGAAGG + Intergenic
965633097 3:170753349-170753371 ATATAAAATAAGATGTGACAAGG + Intronic
966091333 3:176142337-176142359 CAGTAAAATCAGAAGGCACCTGG - Intergenic
966396504 3:179509583-179509605 CTGCAAACCCAGGTGGGACAGGG - Intergenic
967214856 3:187201219-187201241 CTCTAAAATGAGATGTGATATGG + Exonic
967546553 3:190736896-190736918 CTGCAAATTCAGATGGATCATGG - Intergenic
967707136 3:192664368-192664390 CTCTAAAATCAGAAGCGCCAAGG - Intronic
969389892 4:6884726-6884748 CTGTAACAGGAGATGGAACATGG - Intergenic
970982514 4:22117253-22117275 CTGTAATAGCAGAGGGGAAAAGG + Intergenic
971364863 4:25969570-25969592 CTGTCCAATCAGAAGGGAGATGG + Intergenic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
972047314 4:34682820-34682842 CTGTAAACTCAGTTTGCACATGG - Intergenic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
972242633 4:37209833-37209855 CTGTAAAATTAAATGAGAGAAGG - Intergenic
974192659 4:58527157-58527179 ATGCAAAATCTGATGGGAGAAGG - Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
975484909 4:74924902-74924924 CAGTAAAATCAGACTGGACATGG - Intergenic
978270332 4:106881816-106881838 CTGAAACTTCAGATGGGAAATGG - Intergenic
981165090 4:141548354-141548376 CTGTAAAATAAAATAGAACAAGG + Intergenic
983115631 4:163812583-163812605 TTGTAAATTCAGAAGAGACAGGG - Intronic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
987716783 5:21581576-21581598 CTGTATCATCACATGGCACAAGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989783286 5:45296364-45296386 CTGAAAAACCATATGGGACAAGG + Intronic
992727223 5:79620200-79620222 CTGTACGATCAGATGAGTCATGG + Intronic
993648552 5:90489814-90489836 ATGTCAAATCAGACTGGACACGG + Intronic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
996228856 5:121035680-121035702 CTGTAAACTAAGATAGGTCAAGG + Intergenic
996362197 5:122662086-122662108 TTGTAACAGCAGATGGAACATGG + Intergenic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
999017459 5:148123050-148123072 TATTAAAATGAGATGGGACAGGG + Intronic
999116460 5:149168410-149168432 CTCTGAAATCTGAAGGGACAGGG + Intronic
999989067 5:157033026-157033048 CTGCAGAATCAAAAGGGACATGG - Intronic
1000094412 5:157958557-157958579 CTGTAAGATCAGAGAGGACAAGG - Intergenic
1000276077 5:159735852-159735874 CTGTAAAAACAGAGGAGCCAAGG - Intergenic
1001423218 5:171602726-171602748 CTGTAACAAGAGATGGAACATGG - Intergenic
1003805018 6:9718399-9718421 TTTTAAAATCAGATGGAACTGGG + Intronic
1005699632 6:28387442-28387464 CTATAAAATCAGATTAGATAAGG + Intronic
1007984345 6:46192685-46192707 TGATAAAATCAGATGGGACAGGG + Intergenic
1008764991 6:54901256-54901278 CTGTAAACTCCAGTGGGACAGGG + Intronic
1010613332 6:77983587-77983609 GGGTAAAAACAGATGGGAAAGGG - Intergenic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1013081979 6:106821201-106821223 CTCTAAAAACAAATGAGACATGG - Intergenic
1015522138 6:134142163-134142185 CTGTAAAAGACGTTGGGACAGGG + Intergenic
1017146967 6:151242932-151242954 TAGTAAAATCAGATAGGTCAAGG - Intronic
1018703484 6:166446387-166446409 CTGTAGTCTCAGAAGGGACAAGG + Intronic
1019836302 7:3388175-3388197 TTATAAAATGAGATGGGATAAGG + Intronic
1020649584 7:10857964-10857986 CTGCAATAACAGATGGGAGAAGG + Intergenic
1021175869 7:17449359-17449381 CTGGAAAATCTGATGTGACTAGG - Intergenic
1021458861 7:20861992-20862014 CTTAAAAATCTGATGTGACATGG + Intergenic
1022808756 7:33848820-33848842 CTGCAAAAGCAGATTGGAAAGGG - Intergenic
1023087078 7:36581503-36581525 TTGGAAAAACAGATGGGAAATGG + Intronic
1023634437 7:42195475-42195497 CTGTAAAAACAGATGTGAGGAGG - Intronic
1024441874 7:49429199-49429221 CTGTAAAATAAGGTTAGACATGG - Intergenic
1024969597 7:55056114-55056136 CTGAAAAATCAGATAGGTGAGGG + Intronic
1026615425 7:71898383-71898405 GTGTAACAGCAGATTGGACATGG + Intronic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1031185558 7:118475274-118475296 TTGTAAGATGAGATGGGATAAGG + Intergenic
1032775572 7:135109531-135109553 CTGAAAAATCCGAGGTGACAAGG - Intronic
1032860300 7:135871911-135871933 CTGTAAAACCATATGGGCCTGGG + Intergenic
1034015494 7:147580409-147580431 CTGTAAAACTAGATGTGACTAGG - Intronic
1035786694 8:2266686-2266708 CTGCAAAATCAAAGGGGAGACGG - Intergenic
1035806113 8:2455030-2455052 CTGCAAAATCAAAGGGGAGACGG + Intergenic
1038628003 8:29212914-29212936 ATGTATAATCAGATGGCACATGG + Intronic
1039972424 8:42331467-42331489 CTGTAAAGTGAGAGAGGACAGGG - Exonic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1041288892 8:56289322-56289344 ATGTAATATCAGATGAGATAGGG + Intergenic
1041343811 8:56874334-56874356 CTGAAAAACAAGATGGGACCTGG - Intergenic
1041717637 8:60946437-60946459 CTGTAATACCAGATTGAACATGG + Intergenic
1042358985 8:67860921-67860943 CTGTAATACCAGAGGGGTCAAGG - Intergenic
1043193941 8:77266260-77266282 CTTTAAAATCTGGTGGGACAAGG - Intergenic
1044273393 8:90272841-90272863 CTCTGAAGTCAGATGGCACAAGG - Intergenic
1044376044 8:91472300-91472322 CTGCAAAATCAGAAAGGAGATGG - Intergenic
1044400023 8:91759596-91759618 CTGTAACATCACATGGCAGATGG - Intergenic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1045356808 8:101396653-101396675 CTGTAACAGCAGAAAGGACAGGG + Intergenic
1046919410 8:119712192-119712214 CTGTAAAGTCATCTGGGACTGGG + Intergenic
1050027637 9:1352214-1352236 CTTTTAAATCAAATGGGAAAGGG + Intergenic
1055224991 9:73984839-73984861 CTGTAAAATCTGAAGTGACTAGG + Intergenic
1055498390 9:76878625-76878647 CTGTAAAATCTGCAAGGACAAGG + Intronic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1056695140 9:88842320-88842342 CTGTAAAGTCAGATGAAAGATGG - Intergenic
1057210106 9:93196402-93196424 CAGCAACATCAGCTGGGACATGG + Intronic
1060401401 9:123351578-123351600 ATGCAAAATCAAATGGCACATGG - Intergenic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1186273651 X:7917297-7917319 CTGTAAAATCAGATGCCTAAAGG + Intronic
1186334894 X:8575811-8575833 CTGTAAAACCAGGTCAGACATGG + Intronic
1187934822 X:24325661-24325683 CTGTAAAGTCATATAGGAAATGG + Intergenic
1188722119 X:33535254-33535276 CTGAGAAATCATAGGGGACATGG - Intergenic
1190133151 X:47769175-47769197 CTGGAAAATCTGAGGCGACAAGG + Intergenic
1190436007 X:50426186-50426208 CTGTAAAATGAGCTGGTACAGGG - Intronic
1190553187 X:51606285-51606307 CTGTAAAAACAGATGACAGAAGG - Intergenic
1190936123 X:55000638-55000660 AAGTAAAATTACATGGGACAGGG - Intronic
1193191281 X:78573761-78573783 CTGTCAAAACAGGTGGTACATGG - Intergenic
1193370777 X:80694521-80694543 CTGTGAAAGCAGCTGGGAAAGGG + Intronic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1194187349 X:90790042-90790064 CTGAAGAATAAGATGGGAAAAGG + Intergenic
1195298445 X:103503194-103503216 CTGTAAAAACATATGCGCCAGGG + Intronic
1196458525 X:115906540-115906562 CTTTAATAACAGATGGCACAGGG - Intergenic
1197090497 X:122530544-122530566 CTGTAAAATCATCTGGTCCAGGG - Intergenic
1197130040 X:122994828-122994850 CTGGTAAATCAGATGGGTCAGGG - Intergenic
1197261793 X:124327760-124327782 CAGTAAAGGCAGATGGGAAAAGG + Intronic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1200533943 Y:4371999-4372021 CTGAAGAATAAGATGGGAAAAGG + Intergenic
1201742080 Y:17335120-17335142 CTGGAAAATCAGATAGAAAAGGG + Intergenic