ID: 1073112684

View in Genome Browser
Species Human (GRCh38)
Location 10:101072018-101072040
Sequence CAGATAAAAGAGATGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073112684_1073112692 6 Left 1073112684 10:101072018-101072040 CCTCCATCCATCTCTTTTATCTG No data
Right 1073112692 10:101072047-101072069 TGAAGGGCTAGAGCTCCAATGGG No data
1073112684_1073112693 7 Left 1073112684 10:101072018-101072040 CCTCCATCCATCTCTTTTATCTG No data
Right 1073112693 10:101072048-101072070 GAAGGGCTAGAGCTCCAATGGGG No data
1073112684_1073112695 18 Left 1073112684 10:101072018-101072040 CCTCCATCCATCTCTTTTATCTG No data
Right 1073112695 10:101072059-101072081 GCTCCAATGGGGCCTCTGATGGG No data
1073112684_1073112690 -10 Left 1073112684 10:101072018-101072040 CCTCCATCCATCTCTTTTATCTG No data
Right 1073112690 10:101072031-101072053 CTTTTATCTGGGCTGATGAAGGG No data
1073112684_1073112694 17 Left 1073112684 10:101072018-101072040 CCTCCATCCATCTCTTTTATCTG No data
Right 1073112694 10:101072058-101072080 AGCTCCAATGGGGCCTCTGATGG No data
1073112684_1073112696 19 Left 1073112684 10:101072018-101072040 CCTCCATCCATCTCTTTTATCTG No data
Right 1073112696 10:101072060-101072082 CTCCAATGGGGCCTCTGATGGGG No data
1073112684_1073112691 5 Left 1073112684 10:101072018-101072040 CCTCCATCCATCTCTTTTATCTG No data
Right 1073112691 10:101072046-101072068 ATGAAGGGCTAGAGCTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073112684 Original CRISPR CAGATAAAAGAGATGGATGG AGG (reversed) Intergenic
No off target data available for this crispr