ID: 1073112690

View in Genome Browser
Species Human (GRCh38)
Location 10:101072031-101072053
Sequence CTTTTATCTGGGCTGATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073112681_1073112690 1 Left 1073112681 10:101072007-101072029 CCCCAAAGTCACCTCCATCCATC No data
Right 1073112690 10:101072031-101072053 CTTTTATCTGGGCTGATGAAGGG No data
1073112680_1073112690 2 Left 1073112680 10:101072006-101072028 CCCCCAAAGTCACCTCCATCCAT No data
Right 1073112690 10:101072031-101072053 CTTTTATCTGGGCTGATGAAGGG No data
1073112682_1073112690 0 Left 1073112682 10:101072008-101072030 CCCAAAGTCACCTCCATCCATCT No data
Right 1073112690 10:101072031-101072053 CTTTTATCTGGGCTGATGAAGGG No data
1073112679_1073112690 27 Left 1073112679 10:101071981-101072003 CCTCTGGGCTTGTGAGGAGGGGC No data
Right 1073112690 10:101072031-101072053 CTTTTATCTGGGCTGATGAAGGG No data
1073112684_1073112690 -10 Left 1073112684 10:101072018-101072040 CCTCCATCCATCTCTTTTATCTG No data
Right 1073112690 10:101072031-101072053 CTTTTATCTGGGCTGATGAAGGG No data
1073112683_1073112690 -1 Left 1073112683 10:101072009-101072031 CCAAAGTCACCTCCATCCATCTC No data
Right 1073112690 10:101072031-101072053 CTTTTATCTGGGCTGATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073112690 Original CRISPR CTTTTATCTGGGCTGATGAA GGG Intergenic
No off target data available for this crispr