ID: 1073112693

View in Genome Browser
Species Human (GRCh38)
Location 10:101072048-101072070
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073112684_1073112693 7 Left 1073112684 10:101072018-101072040 CCTCCATCCATCTCTTTTATCTG No data
Right 1073112693 10:101072048-101072070 GAAGGGCTAGAGCTCCAATGGGG No data
1073112682_1073112693 17 Left 1073112682 10:101072008-101072030 CCCAAAGTCACCTCCATCCATCT No data
Right 1073112693 10:101072048-101072070 GAAGGGCTAGAGCTCCAATGGGG No data
1073112688_1073112693 0 Left 1073112688 10:101072025-101072047 CCATCTCTTTTATCTGGGCTGAT No data
Right 1073112693 10:101072048-101072070 GAAGGGCTAGAGCTCCAATGGGG No data
1073112683_1073112693 16 Left 1073112683 10:101072009-101072031 CCAAAGTCACCTCCATCCATCTC No data
Right 1073112693 10:101072048-101072070 GAAGGGCTAGAGCTCCAATGGGG No data
1073112687_1073112693 4 Left 1073112687 10:101072021-101072043 CCATCCATCTCTTTTATCTGGGC No data
Right 1073112693 10:101072048-101072070 GAAGGGCTAGAGCTCCAATGGGG No data
1073112680_1073112693 19 Left 1073112680 10:101072006-101072028 CCCCCAAAGTCACCTCCATCCAT No data
Right 1073112693 10:101072048-101072070 GAAGGGCTAGAGCTCCAATGGGG No data
1073112681_1073112693 18 Left 1073112681 10:101072007-101072029 CCCCAAAGTCACCTCCATCCATC No data
Right 1073112693 10:101072048-101072070 GAAGGGCTAGAGCTCCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073112693 Original CRISPR GAAGGGCTAGAGCTCCAATG GGG Intergenic
No off target data available for this crispr