ID: 1073112696

View in Genome Browser
Species Human (GRCh38)
Location 10:101072060-101072082
Sequence CTCCAATGGGGCCTCTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073112682_1073112696 29 Left 1073112682 10:101072008-101072030 CCCAAAGTCACCTCCATCCATCT No data
Right 1073112696 10:101072060-101072082 CTCCAATGGGGCCTCTGATGGGG No data
1073112688_1073112696 12 Left 1073112688 10:101072025-101072047 CCATCTCTTTTATCTGGGCTGAT No data
Right 1073112696 10:101072060-101072082 CTCCAATGGGGCCTCTGATGGGG No data
1073112687_1073112696 16 Left 1073112687 10:101072021-101072043 CCATCCATCTCTTTTATCTGGGC No data
Right 1073112696 10:101072060-101072082 CTCCAATGGGGCCTCTGATGGGG No data
1073112684_1073112696 19 Left 1073112684 10:101072018-101072040 CCTCCATCCATCTCTTTTATCTG No data
Right 1073112696 10:101072060-101072082 CTCCAATGGGGCCTCTGATGGGG No data
1073112683_1073112696 28 Left 1073112683 10:101072009-101072031 CCAAAGTCACCTCCATCCATCTC No data
Right 1073112696 10:101072060-101072082 CTCCAATGGGGCCTCTGATGGGG No data
1073112681_1073112696 30 Left 1073112681 10:101072007-101072029 CCCCAAAGTCACCTCCATCCATC No data
Right 1073112696 10:101072060-101072082 CTCCAATGGGGCCTCTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073112696 Original CRISPR CTCCAATGGGGCCTCTGATG GGG Intergenic
No off target data available for this crispr