ID: 1073113970

View in Genome Browser
Species Human (GRCh38)
Location 10:101080540-101080562
Sequence AAGAGTCAGTCGTGGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073113960_1073113970 29 Left 1073113960 10:101080488-101080510 CCTTCCTGCTAACCACCAGATTT No data
Right 1073113970 10:101080540-101080562 AAGAGTCAGTCGTGGGAATAAGG No data
1073113964_1073113970 14 Left 1073113964 10:101080503-101080525 CCAGATTTCGGCGTGTGTGTTCT No data
Right 1073113970 10:101080540-101080562 AAGAGTCAGTCGTGGGAATAAGG No data
1073113962_1073113970 25 Left 1073113962 10:101080492-101080514 CCTGCTAACCACCAGATTTCGGC No data
Right 1073113970 10:101080540-101080562 AAGAGTCAGTCGTGGGAATAAGG No data
1073113963_1073113970 17 Left 1073113963 10:101080500-101080522 CCACCAGATTTCGGCGTGTGTGT No data
Right 1073113970 10:101080540-101080562 AAGAGTCAGTCGTGGGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073113970 Original CRISPR AAGAGTCAGTCGTGGGAATA AGG Intergenic
No off target data available for this crispr