ID: 1073114715

View in Genome Browser
Species Human (GRCh38)
Location 10:101085267-101085289
Sequence CTTGAACTCCACCTGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073114710_1073114715 1 Left 1073114710 10:101085243-101085265 CCTGGGAGGTGGAGGTTCAAGTG No data
Right 1073114715 10:101085267-101085289 CTTGAACTCCACCTGGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073114715 Original CRISPR CTTGAACTCCACCTGGGAGG TGG Intergenic
No off target data available for this crispr