ID: 1073114767

View in Genome Browser
Species Human (GRCh38)
Location 10:101085523-101085545
Sequence TGGCCCCAAAAAGCCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073114767_1073114769 -2 Left 1073114767 10:101085523-101085545 CCTGCTCTGGCTTTTTGGGGCCA No data
Right 1073114769 10:101085544-101085566 CACCAGAGCCAGAGCTACAGTGG No data
1073114767_1073114773 9 Left 1073114767 10:101085523-101085545 CCTGCTCTGGCTTTTTGGGGCCA No data
Right 1073114773 10:101085555-101085577 GAGCTACAGTGGCAGTTGATGGG No data
1073114767_1073114772 8 Left 1073114767 10:101085523-101085545 CCTGCTCTGGCTTTTTGGGGCCA No data
Right 1073114772 10:101085554-101085576 AGAGCTACAGTGGCAGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073114767 Original CRISPR TGGCCCCAAAAAGCCAGAGC AGG (reversed) Intergenic