ID: 1073125700

View in Genome Browser
Species Human (GRCh38)
Location 10:101147412-101147434
Sequence TGGCTCCGTATTGGTTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073125700_1073125710 25 Left 1073125700 10:101147412-101147434 CCCCTCCAACCAATACGGAGCCA No data
Right 1073125710 10:101147460-101147482 TAGAGAGTGCTTCTCCACCCTGG No data
1073125700_1073125706 0 Left 1073125700 10:101147412-101147434 CCCCTCCAACCAATACGGAGCCA No data
Right 1073125706 10:101147435-101147457 GAAGCCCTCTCCTCTGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073125700 Original CRISPR TGGCTCCGTATTGGTTGGAG GGG (reversed) Intergenic