ID: 1073129996

View in Genome Browser
Species Human (GRCh38)
Location 10:101182076-101182098
Sequence ATACAAAAATTAGCTAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073129995_1073129996 -8 Left 1073129995 10:101182061-101182083 CCATCTCTACAAAAAATACAAAA No data
Right 1073129996 10:101182076-101182098 ATACAAAAATTAGCTAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073129996 Original CRISPR ATACAAAAATTAGCTAAGCA TGG Intergenic