ID: 1073131352

View in Genome Browser
Species Human (GRCh38)
Location 10:101191026-101191048
Sequence AGTGAGGTGCAGAAGATGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073131352_1073131359 10 Left 1073131352 10:101191026-101191048 CCCGGCATCTTCTGCACCTCACT No data
Right 1073131359 10:101191059-101191081 CGATCCCTCCAGGTGAGCCCAGG 0: 1
1: 0
2: 0
3: 50
4: 142
1073131352_1073131355 0 Left 1073131352 10:101191026-101191048 CCCGGCATCTTCTGCACCTCACT No data
Right 1073131355 10:101191049-101191071 CTGCACTCCCCGATCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073131352 Original CRISPR AGTGAGGTGCAGAAGATGCC GGG (reversed) Intergenic
No off target data available for this crispr