ID: 1073131355

View in Genome Browser
Species Human (GRCh38)
Location 10:101191049-101191071
Sequence CTGCACTCCCCGATCCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073131352_1073131355 0 Left 1073131352 10:101191026-101191048 CCCGGCATCTTCTGCACCTCACT No data
Right 1073131355 10:101191049-101191071 CTGCACTCCCCGATCCCTCCAGG No data
1073131351_1073131355 1 Left 1073131351 10:101191025-101191047 CCCCGGCATCTTCTGCACCTCAC No data
Right 1073131355 10:101191049-101191071 CTGCACTCCCCGATCCCTCCAGG No data
1073131353_1073131355 -1 Left 1073131353 10:101191027-101191049 CCGGCATCTTCTGCACCTCACTC No data
Right 1073131355 10:101191049-101191071 CTGCACTCCCCGATCCCTCCAGG No data
1073131348_1073131355 13 Left 1073131348 10:101191013-101191035 CCTTGGCCTCTCCCCCGGCATCT No data
Right 1073131355 10:101191049-101191071 CTGCACTCCCCGATCCCTCCAGG No data
1073131349_1073131355 7 Left 1073131349 10:101191019-101191041 CCTCTCCCCCGGCATCTTCTGCA No data
Right 1073131355 10:101191049-101191071 CTGCACTCCCCGATCCCTCCAGG No data
1073131350_1073131355 2 Left 1073131350 10:101191024-101191046 CCCCCGGCATCTTCTGCACCTCA No data
Right 1073131355 10:101191049-101191071 CTGCACTCCCCGATCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073131355 Original CRISPR CTGCACTCCCCGATCCCTCC AGG Intergenic
No off target data available for this crispr