ID: 1073138742

View in Genome Browser
Species Human (GRCh38)
Location 10:101234042-101234064
Sequence TGGACCTGCCCTGCTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073138739_1073138742 -10 Left 1073138739 10:101234029-101234051 CCAAGCCTGCTCCTGGACCTGCC No data
Right 1073138742 10:101234042-101234064 TGGACCTGCCCTGCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073138742 Original CRISPR TGGACCTGCCCTGCTTTTTC TGG Intergenic
No off target data available for this crispr