ID: 1073139367

View in Genome Browser
Species Human (GRCh38)
Location 10:101237299-101237321
Sequence AGGGCGGAGGTCTTGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073139367_1073139376 -2 Left 1073139367 10:101237299-101237321 CCTCGGGCCAAGACCTCCGCCCT No data
Right 1073139376 10:101237320-101237342 CTGGCTCCGCCAGTCCTGCGGGG No data
1073139367_1073139373 -4 Left 1073139367 10:101237299-101237321 CCTCGGGCCAAGACCTCCGCCCT No data
Right 1073139373 10:101237318-101237340 CCCTGGCTCCGCCAGTCCTGCGG No data
1073139367_1073139377 -1 Left 1073139367 10:101237299-101237321 CCTCGGGCCAAGACCTCCGCCCT No data
Right 1073139377 10:101237321-101237343 TGGCTCCGCCAGTCCTGCGGGGG No data
1073139367_1073139383 24 Left 1073139367 10:101237299-101237321 CCTCGGGCCAAGACCTCCGCCCT No data
Right 1073139383 10:101237346-101237368 GGCATGCACCAGACCTCAAAAGG No data
1073139367_1073139378 3 Left 1073139367 10:101237299-101237321 CCTCGGGCCAAGACCTCCGCCCT No data
Right 1073139378 10:101237325-101237347 TCCGCCAGTCCTGCGGGGGCCGG No data
1073139367_1073139375 -3 Left 1073139367 10:101237299-101237321 CCTCGGGCCAAGACCTCCGCCCT No data
Right 1073139375 10:101237319-101237341 CCTGGCTCCGCCAGTCCTGCGGG No data
1073139367_1073139384 25 Left 1073139367 10:101237299-101237321 CCTCGGGCCAAGACCTCCGCCCT No data
Right 1073139384 10:101237347-101237369 GCATGCACCAGACCTCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073139367 Original CRISPR AGGGCGGAGGTCTTGGCCCG AGG (reversed) Intergenic
No off target data available for this crispr