ID: 1073140452

View in Genome Browser
Species Human (GRCh38)
Location 10:101243663-101243685
Sequence GTCCATTGGGTAGACGGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073140452_1073140460 29 Left 1073140452 10:101243663-101243685 CCCTAACCGTCTACCCAATGGAC No data
Right 1073140460 10:101243715-101243737 TAGGCTCCCCACAAAGGCTTTGG No data
1073140452_1073140459 23 Left 1073140452 10:101243663-101243685 CCCTAACCGTCTACCCAATGGAC No data
Right 1073140459 10:101243709-101243731 TTTCTGTAGGCTCCCCACAAAGG No data
1073140452_1073140458 10 Left 1073140452 10:101243663-101243685 CCCTAACCGTCTACCCAATGGAC No data
Right 1073140458 10:101243696-101243718 CCTAAAAACAGCATTTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073140452 Original CRISPR GTCCATTGGGTAGACGGTTA GGG (reversed) Intergenic
No off target data available for this crispr