ID: 1073140916

View in Genome Browser
Species Human (GRCh38)
Location 10:101247072-101247094
Sequence AGCAGGGAGTTGAAAGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073140915_1073140916 -8 Left 1073140915 10:101247057-101247079 CCTCTAAGAGAGGAGAGCAGGGA No data
Right 1073140916 10:101247072-101247094 AGCAGGGAGTTGAAAGCTCATGG No data
1073140909_1073140916 22 Left 1073140909 10:101247027-101247049 CCATATTTTTGGTCAAGTAAGAG No data
Right 1073140916 10:101247072-101247094 AGCAGGGAGTTGAAAGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073140916 Original CRISPR AGCAGGGAGTTGAAAGCTCA TGG Intergenic
No off target data available for this crispr