ID: 1073141306

View in Genome Browser
Species Human (GRCh38)
Location 10:101249980-101250002
Sequence CCTGCGCTGGCGGTGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073141306_1073141311 5 Left 1073141306 10:101249980-101250002 CCTCAGGACACCGCCAGCGCAGG No data
Right 1073141311 10:101250008-101250030 GCTTTGAGAGAGTTAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073141306 Original CRISPR CCTGCGCTGGCGGTGTCCTG AGG (reversed) Intergenic
No off target data available for this crispr