ID: 1073144598

View in Genome Browser
Species Human (GRCh38)
Location 10:101272311-101272333
Sequence TAGGGTACTGCAAGCAGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073144584_1073144598 28 Left 1073144584 10:101272260-101272282 CCAGAAGGGACCCATATGACCGG No data
Right 1073144598 10:101272311-101272333 TAGGGTACTGCAAGCAGTGCGGG No data
1073144591_1073144598 18 Left 1073144591 10:101272270-101272292 CCCATATGACCGGGGAGGGGCAC No data
Right 1073144598 10:101272311-101272333 TAGGGTACTGCAAGCAGTGCGGG No data
1073144592_1073144598 17 Left 1073144592 10:101272271-101272293 CCATATGACCGGGGAGGGGCACA No data
Right 1073144598 10:101272311-101272333 TAGGGTACTGCAAGCAGTGCGGG No data
1073144593_1073144598 9 Left 1073144593 10:101272279-101272301 CCGGGGAGGGGCACATGAAGAGG No data
Right 1073144598 10:101272311-101272333 TAGGGTACTGCAAGCAGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073144598 Original CRISPR TAGGGTACTGCAAGCAGTGC GGG Intergenic
No off target data available for this crispr