ID: 1073149571

View in Genome Browser
Species Human (GRCh38)
Location 10:101302605-101302627
Sequence GGTTCCTTCTGAACTCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073149569_1073149571 -7 Left 1073149569 10:101302589-101302611 CCAAAGAGGGCCAATGGGTTCCT No data
Right 1073149571 10:101302605-101302627 GGTTCCTTCTGAACTCTTACTGG No data
1073149564_1073149571 8 Left 1073149564 10:101302574-101302596 CCAGCTTTTTTGAGACCAAAGAG No data
Right 1073149571 10:101302605-101302627 GGTTCCTTCTGAACTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073149571 Original CRISPR GGTTCCTTCTGAACTCTTAC TGG Intergenic
No off target data available for this crispr