ID: 1073150811

View in Genome Browser
Species Human (GRCh38)
Location 10:101310407-101310429
Sequence GAAGCTGGTGCCCCAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073150811_1073150815 -3 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150815 10:101310427-101310449 TTCTCTTCTTTTCCCTTCCGGGG No data
1073150811_1073150826 27 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150826 10:101310457-101310479 CTCTGGGCGGGCCTGAGAGGGGG No data
1073150811_1073150824 25 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150824 10:101310455-101310477 AACTCTGGGCGGGCCTGAGAGGG No data
1073150811_1073150821 14 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150821 10:101310444-101310466 CCGGGGAGTCTAACTCTGGGCGG No data
1073150811_1073150823 24 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150823 10:101310454-101310476 TAACTCTGGGCGGGCCTGAGAGG No data
1073150811_1073150818 10 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150818 10:101310440-101310462 CCTTCCGGGGAGTCTAACTCTGG No data
1073150811_1073150822 15 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150822 10:101310445-101310467 CGGGGAGTCTAACTCTGGGCGGG No data
1073150811_1073150825 26 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150825 10:101310456-101310478 ACTCTGGGCGGGCCTGAGAGGGG No data
1073150811_1073150813 -5 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150813 10:101310425-101310447 GCTTCTCTTCTTTTCCCTTCCGG No data
1073150811_1073150814 -4 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150814 10:101310426-101310448 CTTCTCTTCTTTTCCCTTCCGGG No data
1073150811_1073150819 11 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150819 10:101310441-101310463 CTTCCGGGGAGTCTAACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073150811 Original CRISPR GAAGCTGGTGCCCCAAATGC AGG (reversed) Intergenic
No off target data available for this crispr