ID: 1073150815

View in Genome Browser
Species Human (GRCh38)
Location 10:101310427-101310449
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073150811_1073150815 -3 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150815 10:101310427-101310449 TTCTCTTCTTTTCCCTTCCGGGG No data
1073150808_1073150815 3 Left 1073150808 10:101310401-101310423 CCCAGCCCTGCATTTGGGGCACC No data
Right 1073150815 10:101310427-101310449 TTCTCTTCTTTTCCCTTCCGGGG No data
1073150810_1073150815 -2 Left 1073150810 10:101310406-101310428 CCCTGCATTTGGGGCACCAGCTT No data
Right 1073150815 10:101310427-101310449 TTCTCTTCTTTTCCCTTCCGGGG No data
1073150809_1073150815 2 Left 1073150809 10:101310402-101310424 CCAGCCCTGCATTTGGGGCACCA No data
Right 1073150815 10:101310427-101310449 TTCTCTTCTTTTCCCTTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073150815 Original CRISPR TTCTCTTCTTTTCCCTTCCG GGG Intergenic
No off target data available for this crispr