ID: 1073150824

View in Genome Browser
Species Human (GRCh38)
Location 10:101310455-101310477
Sequence AACTCTGGGCGGGCCTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073150812_1073150824 10 Left 1073150812 10:101310422-101310444 CCAGCTTCTCTTCTTTTCCCTTC No data
Right 1073150824 10:101310455-101310477 AACTCTGGGCGGGCCTGAGAGGG No data
1073150810_1073150824 26 Left 1073150810 10:101310406-101310428 CCCTGCATTTGGGGCACCAGCTT No data
Right 1073150824 10:101310455-101310477 AACTCTGGGCGGGCCTGAGAGGG No data
1073150811_1073150824 25 Left 1073150811 10:101310407-101310429 CCTGCATTTGGGGCACCAGCTTC No data
Right 1073150824 10:101310455-101310477 AACTCTGGGCGGGCCTGAGAGGG No data
1073150816_1073150824 -7 Left 1073150816 10:101310439-101310461 CCCTTCCGGGGAGTCTAACTCTG No data
Right 1073150824 10:101310455-101310477 AACTCTGGGCGGGCCTGAGAGGG No data
1073150809_1073150824 30 Left 1073150809 10:101310402-101310424 CCAGCCCTGCATTTGGGGCACCA No data
Right 1073150824 10:101310455-101310477 AACTCTGGGCGGGCCTGAGAGGG No data
1073150817_1073150824 -8 Left 1073150817 10:101310440-101310462 CCTTCCGGGGAGTCTAACTCTGG No data
Right 1073150824 10:101310455-101310477 AACTCTGGGCGGGCCTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073150824 Original CRISPR AACTCTGGGCGGGCCTGAGA GGG Intergenic
No off target data available for this crispr