ID: 1073151579

View in Genome Browser
Species Human (GRCh38)
Location 10:101315170-101315192
Sequence CCATATATCTGGAGTCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073151575_1073151579 10 Left 1073151575 10:101315137-101315159 CCAGGAGATTAAGAGAATTGAAG No data
Right 1073151579 10:101315170-101315192 CCATATATCTGGAGTCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073151579 Original CRISPR CCATATATCTGGAGTCTGGT AGG Intergenic
No off target data available for this crispr