ID: 1073152715

View in Genome Browser
Species Human (GRCh38)
Location 10:101322792-101322814
Sequence TTATATAGACAGAATTAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073152715_1073152719 24 Left 1073152715 10:101322792-101322814 CCGAGCTAATTCTGTCTATATAA No data
Right 1073152719 10:101322839-101322861 GATTACCCTCTCCATCCAATGGG 0: 1
1: 0
2: 1
3: 2
4: 57
1073152715_1073152717 2 Left 1073152715 10:101322792-101322814 CCGAGCTAATTCTGTCTATATAA No data
Right 1073152717 10:101322817-101322839 GCAGTAATGAAATTCACGGCAGG No data
1073152715_1073152718 23 Left 1073152715 10:101322792-101322814 CCGAGCTAATTCTGTCTATATAA No data
Right 1073152718 10:101322838-101322860 GGATTACCCTCTCCATCCAATGG 0: 1
1: 0
2: 0
3: 8
4: 71
1073152715_1073152716 -2 Left 1073152715 10:101322792-101322814 CCGAGCTAATTCTGTCTATATAA No data
Right 1073152716 10:101322813-101322835 AAAAGCAGTAATGAAATTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073152715 Original CRISPR TTATATAGACAGAATTAGCT CGG (reversed) Intergenic
No off target data available for this crispr