ID: 1073155779

View in Genome Browser
Species Human (GRCh38)
Location 10:101345367-101345389
Sequence GAGCTAAGGAGATCAAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073155779_1073155783 15 Left 1073155779 10:101345367-101345389 CCTGGTCTTGATCTCCTTAGCTC No data
Right 1073155783 10:101345405-101345427 CTCTCTGCCTTCCAAAGTTCTGG No data
1073155779_1073155784 16 Left 1073155779 10:101345367-101345389 CCTGGTCTTGATCTCCTTAGCTC No data
Right 1073155784 10:101345406-101345428 TCTCTGCCTTCCAAAGTTCTGGG 0: 2
1: 47
2: 1845
3: 33140
4: 266278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073155779 Original CRISPR GAGCTAAGGAGATCAAGACC AGG (reversed) Intergenic
No off target data available for this crispr