ID: 1073169247

View in Genome Browser
Species Human (GRCh38)
Location 10:101489075-101489097
Sequence CTAAGTTTTTTCAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 10, 3: 27, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073169247 Original CRISPR CTAAGTTTTTTCAGGGAAGA GGG (reversed) Intronic
900731161 1:4261511-4261533 ATAAGTATTGCCAGGGAAGAAGG + Intergenic
900771746 1:4550593-4550615 ACAACTTTTATCAGGGAAGAGGG + Intergenic
901991474 1:13117832-13117854 ATAAGTTTAATCAGTGAAGAAGG + Intergenic
903857846 1:26347123-26347145 CTAACTCTGTTCAGGGAAGATGG + Intronic
904368334 1:30032532-30032554 TTAAGTATTGCCAGGGAAGAAGG - Intergenic
905216826 1:36414577-36414599 ATAAGTATTTTCAAGGAAGAAGG - Intergenic
905797132 1:40822232-40822254 CTGGGTTCTTTCAGGGGAGAGGG + Intronic
908778866 1:67669838-67669860 CTAAGTTTTATGAGCAAAGAGGG - Intergenic
909671820 1:78197892-78197914 TTCAGTTGTTTCAGGTAAGAGGG + Intergenic
909779908 1:79531335-79531357 ATAAGAATTTTCAAGGAAGATGG - Intergenic
910553506 1:88503279-88503301 TTAAATTTATTCAGGAAAGATGG - Intergenic
911182673 1:94875204-94875226 CTCATTTGTTTCAGGGAAGGAGG - Intronic
911711881 1:101082998-101083020 AAAAGTTCATTCAGGGAAGATGG - Intergenic
912167767 1:107060438-107060460 GTAAGTTGTTTGAGGGAAGCAGG - Intergenic
912281064 1:108314760-108314782 ATAAGATTTTACAGTGAAGATGG - Intergenic
912739439 1:112180167-112180189 CCAGGTATTTTCAGGAAAGATGG - Intergenic
913008160 1:114655652-114655674 CTTTGTATTTTCAGGAAAGACGG + Intronic
915249401 1:154577694-154577716 CTTGGTTTCCTCAGGGAAGAGGG - Exonic
916382358 1:164226098-164226120 ATAACTTTATTCAGGGAAGTAGG - Intergenic
917108619 1:171521322-171521344 CTATGATTTTGAAGGGAAGAAGG - Intronic
917284067 1:173406521-173406543 TTAATTTTTTTAATGGAAGAAGG - Intergenic
918217496 1:182405247-182405269 ATAAATTTAATCAGGGAAGAAGG + Intergenic
918709358 1:187707337-187707359 CTAAGAGTTTTCAGAGAAAAGGG + Intergenic
918752651 1:188291979-188292001 CTAAGATGTTCCAAGGAAGATGG + Intergenic
918783598 1:188733789-188733811 ATGAGTATTGTCAGGGAAGAAGG + Intergenic
920316451 1:205078904-205078926 CCAGCTTTTTTCAGCGAAGAGGG + Intergenic
921170537 1:212543868-212543890 CCAAGTTTTTACAAGAAAGAGGG - Intergenic
921220741 1:212972039-212972061 CTGAGCTTTTCCAGGGAAGGGGG - Intronic
921327560 1:214001829-214001851 ATAATTTTTTTCAGGGGAGGGGG - Intronic
921943621 1:220870480-220870502 AAAAGTTCTTTCAAGGAAGAGGG + Intergenic
923645365 1:235815071-235815093 CTAAGTTTACTAAGGGAAGCAGG - Intronic
924432845 1:244011506-244011528 CTTAGTTTTTTCAGCTAAAATGG + Intergenic
924667205 1:246085420-246085442 ATAACCTTTTTCAGGGGAGAAGG - Intronic
1063839085 10:10049499-10049521 TTAAGGTTTGTCTGGGAAGATGG - Intergenic
1064816480 10:19270763-19270785 CAAAACTTTTTCAGGAAAGAGGG + Intronic
1066346817 10:34595588-34595610 CTAAACTATTTCAAGGAAGAAGG + Intronic
1066539198 10:36426339-36426361 CCAAGTATTGTCAAGGAAGAAGG - Intergenic
1067751007 10:48970974-48970996 CTAATTTTTTTCTATGAAGAAGG + Intronic
1067790056 10:49281211-49281233 ATACATTTTTTCAGGAAAGAAGG + Intergenic
1068241218 10:54302984-54303006 CTAAGTTTTGTAAAGGAAGTGGG - Intronic
1069063031 10:63913859-63913881 CAAAATCTCTTCAGGGAAGAGGG + Intergenic
1069662421 10:70132443-70132465 CTAAGTTTTCCTAAGGAAGATGG - Intronic
1070231886 10:74576529-74576551 CTCATTTTTTCCAGGGAAGAAGG - Intronic
1070623220 10:78029858-78029880 CTAATTGTTTTAAGGGAAGGTGG + Intergenic
1071098397 10:82006948-82006970 ATTAGTGTTTTCAAGGAAGATGG - Intronic
1072240717 10:93493235-93493257 CTAAGATTTTCCGGGGAAGTAGG + Intergenic
1072640108 10:97205366-97205388 CACTGTTTCTTCAGGGAAGAAGG + Intronic
1073169247 10:101489075-101489097 CTAAGTTTTTTCAGGGAAGAGGG - Intronic
1073170368 10:101501867-101501889 GTAGGTGTTTTCTGGGAAGAGGG - Intronic
1073502500 10:103953460-103953482 CTAAGTATTTACAGAAAAGAAGG - Intergenic
1073695435 10:105861138-105861160 CTAACTTTTGTGAGGCAAGAAGG + Intergenic
1073815002 10:107196820-107196842 TTATGTTATTTCAGGGAAGTTGG - Intergenic
1073977367 10:109116730-109116752 ATGAGTATTTCCAGGGAAGAAGG + Intergenic
1076287911 10:129319108-129319130 ATAAGTATTGCCAGGGAAGAAGG + Intergenic
1078345789 11:10547080-10547102 CTAAGTTTTTTATAAGAAGAAGG + Intergenic
1081174605 11:39912217-39912239 CTCCTTTTTTTCAGGGCAGAAGG + Intergenic
1081307744 11:41534302-41534324 CTAAGTTTGTTCAGTCAGGAAGG + Intergenic
1081810209 11:45910186-45910208 GTCAGTTTTATTAGGGAAGAGGG + Intronic
1082202277 11:49386483-49386505 CTAATATATTTCAGGGATGAAGG - Intergenic
1083520266 11:63303840-63303862 CTAAGATTTTTCAGAGAGGGAGG - Intronic
1083546755 11:63554460-63554482 CTAATTTTTTTTAGTGGAGACGG - Intronic
1084271015 11:68029261-68029283 GTAAGTATTGCCAGGGAAGAAGG - Exonic
1085234511 11:75003357-75003379 CTAAGTTCTTTCAGAGAGGTTGG - Intronic
1085726798 11:78961662-78961684 CTCAGTTTTTCCAGTGAAAATGG + Intronic
1086574671 11:88325844-88325866 ATAAGTTATTGAAGGGAAGATGG - Intronic
1086653394 11:89319659-89319681 CTAATATATTTCAGGGATGAAGG + Intergenic
1087943256 11:104126967-104126989 TGAAGTTTTTTGAGGGTAGAAGG + Intronic
1088054555 11:105559162-105559184 CAAAATTTTTTGAGTGAAGAGGG - Intergenic
1089451382 11:118599841-118599863 CTAAGCATTTACAGGGGAGACGG - Intronic
1089939462 11:122400069-122400091 CTTACTTTTTTAATGGAAGATGG - Intergenic
1092849598 12:12614631-12614653 CTAATTTTTTGCAGAGATGAGGG + Intronic
1095211851 12:39503633-39503655 CTATGTGTTTTCAAAGAAGATGG + Intergenic
1095696265 12:45147561-45147583 ATGAGTATTGTCAGGGAAGAAGG - Intergenic
1096803545 12:54126945-54126967 AAAAGTTTTTTGAGGGGAGATGG + Intergenic
1097532790 12:60826327-60826349 CTAAGGTTTCTCTGGGAAGAAGG - Intergenic
1097780433 12:63697122-63697144 CTTAGTTGTTTCAGGAAATAGGG + Intergenic
1097963822 12:65558141-65558163 TCAAGTTTTCTAAGGGAAGAGGG + Intergenic
1098198687 12:68031315-68031337 GTGAGATTTTTCAGTGAAGAAGG + Intergenic
1098437474 12:70483275-70483297 ATAAGTATTGCCAGGGAAGAAGG + Intergenic
1098531389 12:71545872-71545894 GAAAGTTTTTTCAGGGAGTATGG + Intronic
1099896431 12:88653836-88653858 ACAAGTATTGTCAGGGAAGAAGG + Intergenic
1099924971 12:89006209-89006231 GTTAGTTTTTTCAGCAAAGATGG - Intergenic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1103168481 12:118791718-118791740 CTCAGATATTGCAGGGAAGATGG + Intergenic
1105788898 13:23777931-23777953 CTAAGTTTTAAGAGGGAAAATGG + Intronic
1106270437 13:28147841-28147863 AAAGCTTTTTTCAGGGAAGAGGG - Intronic
1107187453 13:37540774-37540796 CTAAAATTTTTTAGGAAAGATGG + Intergenic
1108852599 13:54752098-54752120 CTGAACTTTTTCAGGGAAAAAGG - Intergenic
1109501269 13:63238791-63238813 ATGAGTTTTGCCAGGGAAGAAGG - Intergenic
1109760220 13:66818366-66818388 ATAAGGTTTTTCAGGAGAGAAGG + Intronic
1110520762 13:76473288-76473310 ATAAGTATTGCCAGGGAAGAAGG - Intergenic
1110781255 13:79467795-79467817 CATAGTTTTTTGAGGGGAGAGGG - Intergenic
1111178370 13:84628760-84628782 CTCATTTTTTTCAGGGAAGATGG + Intergenic
1111384635 13:87508438-87508460 CTAAGATGTTTCAGGGAACCTGG - Intergenic
1111462036 13:88558147-88558169 ATAAGTTTTGCCAGGGAAGCAGG + Intergenic
1112665909 13:101572816-101572838 GGAAGTTTTTTCAGGAAAGATGG - Intronic
1114955796 14:27817774-27817796 CTAAGCTTTATCTGGTAAGATGG + Intergenic
1117166993 14:53045394-53045416 GTCAGTTTTTGCAGAGAAGAGGG + Exonic
1117267698 14:54107217-54107239 CAGAGGTTTTTCAGGGAAAAGGG - Intergenic
1117572681 14:57063374-57063396 TTAATTTTTTTCATGGAGGAAGG - Intergenic
1117736944 14:58777331-58777353 CTAAGCTTTTTCAAGGGAGAGGG - Intergenic
1118203449 14:63699373-63699395 GTAAGTTTGTAAAGGGAAGAAGG + Intronic
1118227117 14:63912233-63912255 CTAAGTTGTTGAAGGAAAGAAGG + Intronic
1119917988 14:78420017-78420039 CATAGTTTTTTGGGGGAAGAAGG + Intronic
1120021317 14:79534058-79534080 CTGATTTTTTCCAAGGAAGAAGG - Intronic
1121136344 14:91502247-91502269 TTAAATTTTTTCAGGGGAGGTGG - Intronic
1202852863 14_GL000225v1_random:31728-31750 CTCAGTGTTTTCCGGGAAGGGGG - Intergenic
1125509604 15:40285864-40285886 CTCAGTTGTCTCAGGGAGGAGGG - Intronic
1126553390 15:49958468-49958490 CTATACTTTTTCATGGAAGAAGG + Intronic
1126592904 15:50357521-50357543 CTAATTTTTTTCAGTAGAGACGG - Intergenic
1129483514 15:75845565-75845587 CTAAGTTTACTCAGGTAAGTTGG + Intronic
1129798256 15:78394421-78394443 GGATGTTTTTTGAGGGAAGAGGG - Intergenic
1129814380 15:78539257-78539279 TTAGGTTTTTTCAGGCTAGAAGG - Intergenic
1130145271 15:81269273-81269295 CTAAGGTTTATCAAGGAAGTAGG - Intronic
1136512379 16:30746936-30746958 CTAAGTCTTTTCAGGAGAAATGG - Intergenic
1137822561 16:51459832-51459854 CTCAGTTTTTATAGGAAAGAGGG + Intergenic
1137970140 16:52976582-52976604 CTAAGTTTTGGTTGGGAAGAAGG + Intergenic
1139596248 16:67959999-67960021 AGTAGTTTTTTCATGGAAGAAGG - Intronic
1141013501 16:80425819-80425841 CATAGTGTTTTCAGGAAAGAAGG + Intergenic
1141233270 16:82191211-82191233 TGAATTTTTTTAAGGGAAGAGGG - Intergenic
1143403670 17:6661690-6661712 TTCAGTTATTTCAGGCAAGAGGG + Intergenic
1145045253 17:19609396-19609418 CTAGATATTATCAGGGAAGAGGG + Intergenic
1145077092 17:19865383-19865405 CTAAGTTTTTTGGGGGGAGTAGG - Intronic
1145714584 17:27007942-27007964 CCAAGTCTTTTGAGGGAACAAGG - Intergenic
1146295475 17:31646675-31646697 CTAAGTATTGCCAAGGAAGAAGG + Intergenic
1146850443 17:36217067-36217089 TTAATTTTTTTCAGGGAAGATGG + Intronic
1146977893 17:37131321-37131343 ATAATTTCTTTCAGGGAAGGAGG + Intronic
1147907363 17:43832072-43832094 CTTACTTTTTTCAGAGAGGAAGG + Intronic
1150025447 17:61669363-61669385 GTAATTTTTTTATGGGAAGAAGG - Intergenic
1150311346 17:64131201-64131223 CTAAGATTTTTCAGGTTTGAAGG + Intergenic
1151069547 17:71193124-71193146 CCAAGTTTTTTAAGTAAAGAAGG - Intergenic
1152105332 17:78325373-78325395 CTTCTTTATTTCAGGGAAGAGGG + Intergenic
1153668570 18:7388432-7388454 GTAAGATTTTTCAGAGAAAAAGG - Intergenic
1153973002 18:10243404-10243426 CTGAGGTTTTTCAGGGCATATGG + Intergenic
1155929212 18:31687962-31687984 CTAATTTTTTTCAGTGAATTGGG + Intergenic
1157407014 18:47430242-47430264 CTCAGTTTCCTCATGGAAGAAGG + Intergenic
1157728728 18:49985738-49985760 CTTAGGGTTTTCAGGGAAGAGGG - Intronic
1158034271 18:53005560-53005582 CTAATTTTTTTCAGTAGAGATGG - Intronic
1158710526 18:59833451-59833473 CTAAGCATTTGCAGGCAAGAAGG + Intergenic
1158711372 18:59841102-59841124 CTTTGCTTTTTCAGGGGAGATGG + Intergenic
1159005085 18:63004183-63004205 TGAAGTATTTGCAGGGAAGATGG + Intergenic
1160319938 18:77880826-77880848 GTAAGTTTATTCAGAGAAGTGGG + Intergenic
1161704700 19:5814171-5814193 CTGAGTTTTTGCAGGGCACAGGG - Intergenic
1162218200 19:9153913-9153935 CTAAGTTTTTGCTCGGAAGGGGG + Intronic
1165821598 19:38679990-38680012 GTAAGTTCCTTCAGGGAAAAAGG - Intronic
1168021625 19:53612984-53613006 GTCAGTGTTTACAGGGAAGATGG + Intergenic
926329314 2:11811471-11811493 CTAAGTTTAGTCAGGCAAGAAGG + Intronic
926465988 2:13189175-13189197 CTATTTTTTTTCATGGAAGAAGG - Intergenic
927462917 2:23314440-23314462 CTAAGGTTATCCAGGCAAGATGG - Intergenic
929040007 2:37735468-37735490 CTTTTTTTTTTTAGGGAAGATGG - Intronic
930452045 2:51553923-51553945 TTAAGTTTTTTCAGAGGATAGGG - Intergenic
930798228 2:55415364-55415386 CCCAGTTGTTTCAGGGAGGAGGG - Intronic
930861988 2:56083882-56083904 CTAAGTTTTCTCAAGGTAAATGG + Intergenic
931276775 2:60750868-60750890 CTAGCCTTTTTCAGGAAAGAAGG - Intergenic
932842897 2:75100120-75100142 CTGAGTTTTTTCAGAGAGGCAGG + Intronic
933792726 2:85896004-85896026 ATAAGTATTGTCAGTGAAGAAGG + Intergenic
933874579 2:86606325-86606347 CCTACTTTTTTAAGGGAAGATGG - Intronic
934481478 2:94650296-94650318 CTAAGCTTTATCTGGTAAGATGG - Intergenic
935567082 2:104620509-104620531 TTCAGTTTTCTCAGGGAAGTAGG - Intergenic
936078073 2:109414419-109414441 TTCAGTTTTTTCAGGCAGGAGGG + Intronic
936656203 2:114490431-114490453 CTAATTTCCTTGAGGGAAGAAGG + Intronic
936742458 2:115529756-115529778 CTATTTGTTTTCAGGGAAGCTGG + Intronic
936855850 2:116956408-116956430 ACAAGTATTGTCAGGGAAGAAGG - Intergenic
937390016 2:121477451-121477473 ATATGTTTTATCAGGAAAGAAGG - Intronic
938195240 2:129321083-129321105 CAAAGATGTTTAAGGGAAGATGG - Intergenic
938654790 2:133420074-133420096 CTAATATCTTTTAGGGAAGATGG + Intronic
939622537 2:144438027-144438049 CTAAGGTTTTTGAGGGGAGGTGG - Intronic
940160334 2:150705128-150705150 CCAAGTTTTGTCAAGGAATATGG + Intergenic
940614471 2:156033367-156033389 TTAAGCATTTTGAGGGAAGAAGG - Intergenic
940657311 2:156503605-156503627 ATAAGTATTTACAGGGAAAATGG + Intronic
940990518 2:160091914-160091936 CTCAGGTTTTTCTGGGAAGTAGG - Intergenic
941186579 2:162326825-162326847 CTGAGTTTTTTGTGGAAAGAAGG - Intronic
941295624 2:163735947-163735969 CCAAGTTTTTGAAGGGAAGACGG + Exonic
941351565 2:164443549-164443571 CTATTTTTTTTCAGTTAAGAAGG - Intergenic
944261082 2:197677894-197677916 ATAAGTTTCTTTAGGGCAGAGGG - Intergenic
944626161 2:201570929-201570951 CTAATTCTTGTCAGGGAAGTTGG - Intronic
945493733 2:210484835-210484857 ATCAGTTTTTCCAGGGAAGAAGG - Intronic
946502188 2:220261380-220261402 CTGAATTTTTTCAGAGAAGCTGG + Intergenic
946576772 2:221084145-221084167 TTAAGTTCTGTCAGGGAACATGG + Intergenic
947897285 2:233687440-233687462 CTAAGTATTTACATGGAAGCTGG + Intronic
1169182012 20:3577594-3577616 CTGAGCTTGTTCAGGGAAGTTGG + Intronic
1172363972 20:34334799-34334821 TTAAGTTTTATGAGGGAAAATGG + Intergenic
1173999127 20:47361426-47361448 GTAAGATCTTTCAGGGAAGTGGG + Intergenic
1175440412 20:58986750-58986772 CTAGGTATTTTCAGGCAGGAGGG + Exonic
1177759108 21:25382689-25382711 CTAAGGTTTCTCAAGGATGAAGG - Intergenic
1177802203 21:25839141-25839163 ATGAGTATTATCAGGGAAGAAGG + Intergenic
1178378114 21:32085046-32085068 CTCAGTCTGGTCAGGGAAGATGG - Intergenic
1178473055 21:32911872-32911894 CTGAGGTTTCCCAGGGAAGAAGG - Intergenic
1180666683 22:17518880-17518902 CTAAGTTTTTTTGGGGGAGAAGG - Intronic
1182664544 22:31947810-31947832 CTAAGTGATTTAAGGAAAGAGGG + Intronic
1182867919 22:33620749-33620771 CTAATTTTTTTTAGTGGAGATGG - Intronic
1184832671 22:46999547-46999569 CCAAGTTTGCTCAGGGATGATGG - Intronic
1185067554 22:48639720-48639742 CCAAGTTTTGACAGGGGAGATGG - Intronic
1185074670 22:48676825-48676847 CTAAGTTTCTTCCTGGAAGTGGG + Intronic
949305518 3:2636104-2636126 ACAAGTATTGTCAGGGAAGAAGG - Intronic
949324615 3:2849433-2849455 CTAATTTTTTTTAAAGAAGAAGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950322324 3:12068396-12068418 CCAAATGCTTTCAGGGAAGAGGG - Intronic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
950334338 3:12181774-12181796 CAAAGTTAGTCCAGGGAAGATGG + Intronic
951072380 3:18346521-18346543 AAAATTGTTTTCAGGGAAGATGG - Intronic
952309784 3:32177787-32177809 ATAACTTATTTCAGGGAAGGTGG + Intergenic
953016715 3:39083760-39083782 ATAAGTTTTTACATGGGAGATGG + Intronic
953206621 3:40836531-40836553 CTTAGTTATTTCAGGGAAACTGG + Intergenic
954111503 3:48436097-48436119 CTCAGCTTTTTCTGGGAAAATGG - Intronic
955744027 3:62122134-62122156 CTATGTTTTTTCAGGGTGGGGGG - Intronic
956864647 3:73357054-73357076 CTGAGATCTTCCAGGGAAGAGGG - Intergenic
957116049 3:76028288-76028310 CTATGATTTTTCATGGAAGAGGG - Intronic
957274492 3:78073508-78073530 ATAATCTGTTTCAGGGAAGAAGG - Intergenic
960601291 3:119461412-119461434 AAAACTTTTTTCAGGGAGGAAGG + Intronic
960603679 3:119482945-119482967 CTAGGTCTTTTGAGGGAGGATGG + Intronic
961937708 3:130603338-130603360 CTAAGTGTTTTCTGGGGAAAGGG + Intronic
963311345 3:143713596-143713618 TTAAATTTCTTCAGGGAAGGAGG - Intronic
965019453 3:163209474-163209496 CTAATTTTATCCAGGGAAAAAGG - Intergenic
965491063 3:169337245-169337267 ATAAATTTTTTTAGGCAAGAAGG + Intronic
966483354 3:180438119-180438141 TTCAGTTCTTTCAGGTAAGAAGG - Intergenic
968855870 4:3121532-3121554 ATAAGTTTTGGCAAGGAAGATGG - Intronic
968923331 4:3533817-3533839 TTGAGTTGTTTCAGGCAAGAGGG + Intergenic
969499995 4:7546824-7546846 ATGTGTTTTTGCAGGGAAGAGGG - Intronic
970077520 4:12241278-12241300 CTTAGATTTTTCATGGAGGAGGG + Intergenic
972091150 4:35285720-35285742 CTCAGTTATTTAGGGGAAGATGG - Intergenic
972264899 4:37450897-37450919 ATGAGTATTGTCAGGGAAGAAGG + Intergenic
973059388 4:45701537-45701559 TTAAGTTTCTTCAGGGAATGTGG - Intergenic
973559936 4:52125081-52125103 TTAAGTTATTCCAGGAAAGAGGG + Intergenic
975395330 4:73868600-73868622 CCAACATTTTACAGGGAAGAAGG + Intergenic
975427754 4:74250433-74250455 CTACATTTTCACAGGGAAGATGG - Intronic
976793413 4:88905908-88905930 GTTTGTTTTTTCAGGGAAGTAGG - Intronic
977058120 4:92218751-92218773 TTAAGTGCTTTTAGGGAAGAAGG - Intergenic
977114046 4:92998645-92998667 GTATGTGTTTTCTGGGAAGAGGG + Intronic
977257353 4:94756198-94756220 CTAAGTGTTTTGTGGGGAGAAGG - Intergenic
977703050 4:100042309-100042331 CTCAGTTTTCTCAAGGAAGCAGG + Intergenic
978175210 4:105721805-105721827 CTAAGACTTTTCAGAGGAGAGGG - Intronic
978193144 4:105939355-105939377 GTGAGGTTTTTCAAGGAAGAAGG + Intronic
978365073 4:107972946-107972968 CTAAGTCTTCCCAGGGAAGGGGG - Intergenic
978771342 4:112459175-112459197 CTAGGTTTATTGTGGGAAGAGGG - Intergenic
979524190 4:121699996-121700018 CAAAGGTTTTTCAAGGAAGAAGG + Intergenic
979586438 4:122423883-122423905 CAAAGTTCTTTCTGGGATGATGG + Intronic
979870883 4:125820257-125820279 CTAATTTTATTCAGGGAATAAGG - Intergenic
980801877 4:137762182-137762204 ATAACTTTTTTTAGGCAAGAAGG - Intergenic
981893480 4:149767313-149767335 TCAAGTTTTCTCAGGCAAGATGG - Intergenic
987392876 5:17392460-17392482 CTAAGTCTTTTCAGGGTGCAAGG - Intergenic
987654903 5:20795031-20795053 TTCAGTTTTATAAGGGAAGAAGG + Intergenic
988740741 5:34066906-34066928 TTCAGTTTTATAAGGGAAGAAGG - Intronic
989034263 5:37153242-37153264 TTAAGCATCTTCAGGGAAGATGG + Intronic
990097036 5:52129006-52129028 CCAAGGGTTTGCAGGGAAGAAGG + Intergenic
990137347 5:52662367-52662389 CTAAGTTTTTATAGCCAAGATGG - Intergenic
990773443 5:59277465-59277487 CTAATTATTTTTAGGGGAGAGGG + Intronic
991293028 5:65051055-65051077 CTAAGTTTCTGCAGGGCTGATGG + Intergenic
991405645 5:66298728-66298750 CAAAGGTTTTTGAGGGAATAAGG + Intergenic
992125653 5:73637319-73637341 CTAAGTTTCTTGAGAGAAGGAGG - Intronic
993733291 5:91447255-91447277 CCTAGTTTCTTCAGGGAGGAAGG + Intergenic
994231117 5:97311537-97311559 CTAATTTTTTTTAAGGAGGAAGG + Intergenic
994282243 5:97919556-97919578 GAAAGATTTTTCAGGAAAGATGG + Intergenic
995071969 5:107933598-107933620 TTAAGTCTATTCAGGGAACAGGG - Intronic
995196470 5:109375111-109375133 TTAGAATTTTTCAGGGAAGAAGG + Intronic
995383372 5:111561732-111561754 GGAAGTTTTTTCTGGGCAGAAGG + Intergenic
996123353 5:119695964-119695986 CTAAGTTGTTTTGGGGAATATGG + Intergenic
1000814929 5:165909184-165909206 ACAAGTATTTCCAGGGAAGAAGG + Intergenic
1001296049 5:170499846-170499868 CTAAGGTTGTTCAGGGAGGAAGG - Intronic
1002756850 6:169304-169326 GTAAGATTTTTCAGGGGAAAAGG + Intergenic
1002905186 6:1442625-1442647 ATGAGTTTTGCCAGGGAAGAAGG - Intergenic
1005026843 6:21470970-21470992 CTAAGTTGTTTTATGGAAAAAGG - Intergenic
1005654608 6:27921941-27921963 CTAATTTCTTTCAGTGGAGAAGG + Intergenic
1006696398 6:35933920-35933942 CCAAGTTGTTTCAGAGAAGAGGG - Intergenic
1006808222 6:36802732-36802754 CTAACTTAATTCAGGGTAGAAGG - Intronic
1007688875 6:43684997-43685019 CTAAGAGCTTTCAGGGAAGGAGG + Intronic
1010375748 6:75168232-75168254 ATAATTTTTTTTAGGGAGGAGGG + Intronic
1010661625 6:78578079-78578101 CAAAGTCTTTGGAGGGAAGAGGG + Intergenic
1011008624 6:82677915-82677937 ACAAGTATTTTTAGGGAAGAAGG + Intergenic
1012890190 6:104888277-104888299 ATAAGTATTGCCAGGGAAGAAGG - Intergenic
1013068365 6:106705323-106705345 CTGAGTATTGCCAGGGAAGAAGG + Intergenic
1013277602 6:108600762-108600784 CTAATTTTTATAAGGGAAGAAGG + Intronic
1013280377 6:108630770-108630792 AAAAGCTTTTTAAGGGAAGAAGG + Intronic
1014002306 6:116378130-116378152 CTTCTTTTCTTCAGGGAAGATGG - Intronic
1021604333 7:22395111-22395133 CTGAGTATTGCCAGGGAAGAAGG - Intergenic
1021678422 7:23105171-23105193 CTAAGTGTTTTACGGGAACACGG - Intergenic
1022939009 7:35213197-35213219 CTTAGTTGTTTCAGGAAATAGGG + Intronic
1024938756 7:54740275-54740297 TTAAGTTTTCTCAGAGAAGATGG - Intergenic
1026289243 7:68991049-68991071 CCATGTTTTTTCAGGGACAAGGG - Intergenic
1026320228 7:69261568-69261590 CTAATTTTTTTTAGGGGATAAGG - Intergenic
1026398712 7:69986640-69986662 CTAAGTTTTCTGAGAGTAGAAGG + Intronic
1026841670 7:73672744-73672766 TTAAGTTTTTTACTGGAAGAGGG + Intergenic
1027625814 7:80543777-80543799 ATGAGTATTGTCAGGGAAGAAGG + Intronic
1028090274 7:86691760-86691782 CTAAGTCATTTCATGGCAGAAGG - Intronic
1030191433 7:106814317-106814339 CTAAGTTGTTTAGGGGAAAATGG - Intergenic
1030429351 7:109422931-109422953 CTAATTTTTTAAAGCGAAGAAGG - Intergenic
1031078697 7:117238311-117238333 GTATGTTTGTTCAGGGAAGGGGG + Intergenic
1032729376 7:134622822-134622844 CCCAGTTTTCTCAGGAAAGAAGG + Intergenic
1034233169 7:149548465-149548487 ACAAGTATTGTCAGGGAAGAAGG - Intergenic
1034465439 7:151225772-151225794 GTAAGTTTTTGGAGGGAAGACGG + Intronic
1037529318 8:19757738-19757760 CAAAGTTTTTGCATGGAAGTCGG - Intronic
1037936576 8:22918864-22918886 CCAAGGGTTTCCAGGGAAGAGGG + Intronic
1038176005 8:25182936-25182958 ATAAATTATTTTAGGGAAGATGG + Intergenic
1038355624 8:26826428-26826450 TTAATTTTTTGCATGGAAGAAGG - Intronic
1038584083 8:28773983-28774005 CTAATTTTTTTTAGTGGAGATGG + Intronic
1039162878 8:34642019-34642041 GTAAGTATTGTCAGGGAAGAAGG + Intergenic
1039215715 8:35268104-35268126 CTAAGTTTTCTAAGGGAATATGG - Intronic
1039288606 8:36069469-36069491 CTAAGTTTTTTGAGAGATGCAGG - Intergenic
1039458794 8:37726588-37726610 CTAAGTTTTTTCATAAAGGAGGG - Intergenic
1039656996 8:39421177-39421199 ATAAGTATTGCCAGGGAAGATGG + Intergenic
1039896217 8:41718561-41718583 ATCAGTGGTTTCAGGGAAGAGGG - Intronic
1042530839 8:69813445-69813467 CTAAGTTATATTAGGGAACAAGG + Intronic
1042907596 8:73787855-73787877 CTGAGTGTTTTCAGTGAAGATGG - Intronic
1043515564 8:80991759-80991781 GTATGTTTTTTCCCGGAAGAAGG - Intronic
1043703311 8:83318264-83318286 CTAAGTATTGCCAGGGAAGAAGG - Intergenic
1050455501 9:5831107-5831129 CTAAGCTTTTTTGGGGAGGAAGG - Intronic
1050620116 9:7443272-7443294 ATAAGTTGTTTAAGTGAAGATGG + Intergenic
1051336781 9:16072797-16072819 CTAGGGTATCTCAGGGAAGATGG - Intergenic
1051447944 9:17162072-17162094 CAAAGCTTTCTCAGTGAAGAGGG - Intronic
1051580963 9:18673718-18673740 ATAAATTTTTTCAGGAGAGAAGG + Intronic
1052154737 9:25171246-25171268 CTAAGTATTTTCAGAGTATAGGG + Intergenic
1053328285 9:37177167-37177189 CTAAGTATTTTCAGTAGAGACGG - Intronic
1053676357 9:40433811-40433833 CTAAGCTTTATCTGGTAAGATGG + Intergenic
1054287362 9:63191082-63191104 CTAAGCTTTATCTGGTAAGATGG - Intergenic
1054289424 9:63269336-63269358 CTAAGCTTTATCTGGTAAGATGG + Intergenic
1054387457 9:64573882-64573904 CTAAGCTTTATCTGGTAAGATGG + Intergenic
1054508265 9:65942483-65942505 CTAAGCTTTATCTGGTAAGATGG - Intergenic
1057395791 9:94678889-94678911 GTAAGTATTGCCAGGGAAGAAGG + Intergenic
1058113540 9:101058076-101058098 CTAGGTGTGTTCAAGGAAGAAGG - Intronic
1059800493 9:117745253-117745275 CTCGGCTTTTTCAGGGAGGACGG + Intergenic
1059945548 9:119405153-119405175 CTAAATTTTTGAAGAGAAGAAGG - Intergenic
1060447166 9:123700586-123700608 CTGAGGTTTTCCAGAGAAGAAGG - Intronic
1061358997 9:130128957-130128979 CTGGGTCTTGTCAGGGAAGATGG + Intronic
1061672921 9:132199100-132199122 CTGAGCTTTTCCACGGAAGAAGG + Intronic
1186594099 X:10961816-10961838 CTCAGTTTTGTCAGAGAAGGTGG - Intergenic
1188187486 X:27132044-27132066 ATGAGTATTTCCAGGGAAGAAGG - Intergenic
1189390503 X:40572462-40572484 TTAGGTTTTTTCAGGGGAGTTGG + Intergenic
1192143076 X:68661394-68661416 ATGAGTTTTTTCAGAGAAAAGGG - Intronic
1192490589 X:71573403-71573425 CTAAGTTTTTTCAGAGTATATGG + Intronic
1193373471 X:80728374-80728396 CATAGTTTTTTCAAGGAATAGGG - Intronic
1193882511 X:86940889-86940911 CAATGTTTTTTGAGGAAAGATGG + Intergenic
1194292792 X:92095833-92095855 CTAAGATTTTTCTAGGAAAATGG - Intronic
1194936311 X:99953517-99953539 ATAAGTTTGTTCAGGTAAAAAGG + Intergenic
1195234479 X:102883205-102883227 CTAAGTTATTTCAGGGAATCAGG - Intergenic
1195292948 X:103446691-103446713 TAAAGTTATTTCAGGGAAGCAGG - Intergenic
1195300496 X:103525320-103525342 CTCAGTTATTTCAGGGAGGCAGG + Intergenic
1195551795 X:106180028-106180050 CTAAGTTTTTTCTCTTAAGAAGG + Intronic
1195871726 X:109493487-109493509 CTAAGATATTTCAGGGATAAGGG - Intergenic
1196774248 X:119323594-119323616 GTAATTTTTTTCAGAGAAGAGGG - Intergenic
1197020527 X:121682393-121682415 TTAAGTCTTTTCAGTGAAGTAGG + Intergenic
1198071423 X:133152103-133152125 GTAAGGTTGTTCAGGGAAGGAGG - Intergenic
1198558077 X:137817468-137817490 TTTAGTTTTTTCAGGCCAGAGGG + Intergenic
1199211647 X:145218925-145218947 GTATGTTTTTTGAGGGAGGAAGG - Intergenic
1199840054 X:151636854-151636876 GGAAGTTTTTTGAGGGATGATGG - Intronic
1199868411 X:151874890-151874912 CTAAAATTTTCCAGTGAAGATGG + Intergenic
1199890085 X:152070404-152070426 TTCAGATTTTTCAGGGATGAAGG + Intergenic
1200610299 Y:5320395-5320417 CTAAGATTTTTCTAGGAAAATGG - Intronic
1200685005 Y:6250257-6250279 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200990535 Y:9341527-9341549 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200993197 Y:9361844-9361866 CTATGTTGTTTCAGGGAAGAGGG + Intronic
1200995851 Y:9382115-9382137 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200998515 Y:9402467-9402489 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201001025 Y:9470997-9471019 CTATGTTGTTTCAGGGAAGAGGG + Intronic
1201003692 Y:9491325-9491347 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201006348 Y:9511606-9511628 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201009005 Y:9531915-9531937 GCATGTTGTTTCAGGGAAGAGGG + Intergenic
1201063040 Y:10065437-10065459 CTATATTGTTTCAGGAAAGAGGG - Intergenic