ID: 1073169903 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:101497455-101497477 |
| Sequence | CTTTGGAATGCCCAGGTGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1073169899_1073169903 | -8 | Left | 1073169899 | 10:101497440-101497462 | CCTGTAATCCTGGCACTTTGGAA | 0: 57 1: 2587 2: 37511 3: 327670 4: 251478 |
||
| Right | 1073169903 | 10:101497455-101497477 | CTTTGGAATGCCCAGGTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1073169903 | Original CRISPR | CTTTGGAATGCCCAGGTGGA AGG | Intronic | ||
| No off target data available for this crispr | |||||