ID: 1073169903

View in Genome Browser
Species Human (GRCh38)
Location 10:101497455-101497477
Sequence CTTTGGAATGCCCAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073169899_1073169903 -8 Left 1073169899 10:101497440-101497462 CCTGTAATCCTGGCACTTTGGAA 0: 57
1: 2587
2: 37511
3: 327670
4: 251478
Right 1073169903 10:101497455-101497477 CTTTGGAATGCCCAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073169903 Original CRISPR CTTTGGAATGCCCAGGTGGA AGG Intronic
No off target data available for this crispr