ID: 1073173432

View in Genome Browser
Species Human (GRCh38)
Location 10:101533402-101533424
Sequence TACAGTTACCACTACCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073173432_1073173434 15 Left 1073173432 10:101533402-101533424 CCTTTCAGGTAGTGGTAACTGTA 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1073173434 10:101533440-101533462 ATCTCCTTTGAAACATGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073173432 Original CRISPR TACAGTTACCACTACCTGAA AGG (reversed) Intronic
901364152 1:8731121-8731143 TACAGTAATCAATACCTGAACGG + Intronic
904926149 1:34049773-34049795 AACAATTACCACTACCTGGATGG + Intronic
907352983 1:53848761-53848783 CACAGTTACCCCTAGCTGCAAGG - Intergenic
907582009 1:55580802-55580824 TACAGTTTCCAATTCGTGAATGG + Intergenic
909027275 1:70496798-70496820 TTCAGCTACCACTATATGAAAGG + Intergenic
910322421 1:85962486-85962508 TTTATTTACCACTACCAGAAGGG - Intronic
916827294 1:168454531-168454553 TGCAGTTAGCACTTCCAGAAAGG + Intergenic
1063937725 10:11096366-11096388 TACAGTTGCCACTAAGTGTAAGG - Intronic
1065479339 10:26176857-26176879 TAGAGTTAGAACTTCCTGAATGG + Intronic
1067756688 10:49011099-49011121 GACAGTTCCCACTCCCAGAATGG + Intergenic
1068226604 10:54114768-54114790 TGCTATTTCCACTACCTGAAAGG - Intronic
1073173432 10:101533402-101533424 TACAGTTACCACTACCTGAAAGG - Intronic
1080364948 11:31563118-31563140 TACAGTTACCAAAACCTGGAAGG + Intronic
1083108087 11:60377762-60377784 TACAGTCTCCATTTCCTGAAGGG - Intronic
1087109026 11:94442921-94442943 TCCAGATACCACTCCCTAAATGG + Intronic
1094190655 12:27694985-27695007 TACAGTTACCACATAATGAATGG - Exonic
1097939279 12:65286008-65286030 CATAGTTACTACTACATGAAAGG - Intronic
1099432928 12:82609693-82609715 TGCAGTTAACAAGACCTGAAAGG + Intergenic
1101060992 12:100971399-100971421 TACATTTCCACCTACCTGAAAGG - Exonic
1105729716 13:23200808-23200830 TATAATTCCCACTACCTGGAAGG - Intronic
1108206640 13:48096370-48096392 TACAGGTACTACTACCTCATGGG - Intergenic
1109365493 13:61350792-61350814 CTCAATTACCTCTACCTGAATGG - Intergenic
1110039571 13:70735943-70735965 TACAGTTAATACTGCATGAATGG - Intergenic
1115633736 14:35270589-35270611 AACAGGTACCATTACCTGAAAGG - Exonic
1118482418 14:66180595-66180617 CACAGCTCCCTCTACCTGAAAGG + Intergenic
1123158865 14:106257957-106257979 TTCAGTTACTACTACATGAGCGG - Intergenic
1126694694 15:51315973-51315995 GACAGTTAGCAGAACCTGAATGG + Intronic
1130228317 15:82076806-82076828 TACTGTCACCACCACCTGGAAGG - Intergenic
1134570415 16:15285847-15285869 TACAGTTACCTCAACCTGTGAGG - Intergenic
1134731962 16:16470216-16470238 TACAGTTACCTCAACCTGTGAGG + Intergenic
1134935482 16:18241789-18241811 TACAGTTACCTCAACCTGTGAGG - Intergenic
1137738815 16:50744722-50744744 TACAATTACCACATTCTGAAAGG - Intronic
1140290162 16:73645869-73645891 TACAGTTACCATCACCTCCAAGG - Intergenic
1144801710 17:17933349-17933371 TACAGTCACCCCTAGCTGCAAGG + Intronic
1151008688 17:70467876-70467898 TACACTTTCCACTACAAGAAAGG - Intergenic
1153959257 18:10126934-10126956 TACAGTTACCATGTCCTGGAGGG - Intergenic
1157349882 18:46874911-46874933 TACAGAAACCACTATCTGCACGG + Intronic
1157848684 18:51028066-51028088 CACAGTTGCCACTACTTGAGAGG + Intronic
1165844018 19:38806581-38806603 TCCATTTACCACCACCTGGAGGG + Exonic
1168631663 19:57961376-57961398 TACAGGTCACACTACCTGAGTGG + Exonic
931942822 2:67271794-67271816 TAGAGGTAGCACTACCTGAAAGG - Intergenic
932851672 2:75193624-75193646 TACAGCTTCTTCTACCTGAAAGG + Intronic
932998758 2:76893519-76893541 TACAGATAGTTCTACCTGAAAGG + Intronic
933269960 2:80222736-80222758 TAAAGTTATCACTGCCTGATAGG - Intronic
935741726 2:106154686-106154708 TGCAGTTACCACCATCTGAGTGG - Intronic
938776305 2:134544445-134544467 TACAGTAGCCACTAGCTGCATGG + Intronic
940527162 2:154831198-154831220 AACAGTTACCCCTTACTGAATGG + Intronic
1170330034 20:15199040-15199062 TCCAGTTGCCACTATCTAAAAGG - Intronic
1172286874 20:33746856-33746878 TAGAGTTGCCACTAGCTGAAGGG + Intronic
1181667506 22:24408318-24408340 AACAGTTACCACTCCATAAAGGG - Intronic
1183799050 22:40146245-40146267 CACACATATCACTACCTGAAAGG - Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
961105688 3:124239122-124239144 TACAGTTACTTGTACGTGAAAGG + Intronic
963694711 3:148551784-148551806 TACAGTAACCACCACTTGAAGGG + Intergenic
964459185 3:156903775-156903797 TACATCTACTGCTACCTGAAAGG + Intronic
965075191 3:163966479-163966501 TACTGTACTCACTACCTGAATGG + Intergenic
965584058 3:170299546-170299568 TACAAATACCAGTAACTGAATGG - Intronic
966244024 3:177786025-177786047 TCCAGATACCACTTCCTGAGAGG + Intergenic
972575375 4:40346297-40346319 TGCAGTTACCAGAACCTGGAAGG - Intronic
975264450 4:72345433-72345455 TAAAGTTATCACTTCCTAAAAGG + Intronic
981491426 4:145344452-145344474 GTCAGTTACCACTATCTGAAAGG - Intergenic
982498910 4:156129798-156129820 TACAGTGACCACTAACAGGATGG + Intergenic
983327923 4:166283643-166283665 TTCAGTTACTACTATCTGATGGG - Intergenic
985078139 4:186238352-186238374 TACAATTACCAATTTCTGAAAGG - Exonic
992364118 5:76074306-76074328 AAGAGCTACCATTACCTGAATGG - Intergenic
993394450 5:87366546-87366568 TACATTTACCACTTGCTGTAAGG + Intronic
993762077 5:91807763-91807785 AACAGTTACCATTACCTGTATGG + Intergenic
997062769 5:130526858-130526880 TGCAGTTTCCACCAGCTGAAAGG - Intergenic
998520962 5:142800173-142800195 TAAAATTTGCACTACCTGAAAGG + Intronic
1000491275 5:161916714-161916736 CACATTTACCTTTACCTGAAGGG + Intergenic
1010442681 6:75915965-75915987 TACAATTACCAAAACCTCAAAGG - Exonic
1014410270 6:121108391-121108413 GACAGTCACCACTCTCTGAAAGG + Intronic
1020639577 7:10738729-10738751 CACAGTAACCACTAGCTGCATGG - Intergenic
1023390214 7:39702965-39702987 TATAGTTTCAAATACCTGAAAGG + Intronic
1026258521 7:68733975-68733997 TCCAGTTTCCAGTACCTAAAAGG + Intergenic
1034427737 7:151023484-151023506 TACAGCTACCACCAGCGGAATGG - Exonic
1040581552 8:48702671-48702693 TTCAGTTACCTATACCTGCAGGG + Intergenic
1043240865 8:77933797-77933819 TACAGGTGCCACTTTCTGAATGG - Intergenic
1047376401 8:124301375-124301397 GACAGTTACAAGCACCTGAACGG + Intergenic
1048965583 8:139612154-139612176 TGCCGTTCCCACTACCTGGAAGG - Intronic
1050139819 9:2505827-2505849 TTCAGTTACCACTACTAGGAGGG - Intergenic
1051072689 9:13191642-13191664 CACAGTTACCACTTAGTGAATGG - Intronic
1051195102 9:14555644-14555666 TTCAGTTATCACTTCCTGGAGGG - Intergenic
1189531969 X:41893900-41893922 AACAATAACCACTACCTGAGTGG + Intronic
1194885072 X:99304643-99304665 CACAGTCACCATTAGCTGAAAGG + Intergenic
1195574864 X:106438334-106438356 AGCAGTTACCAGAACCTGAAGGG - Intergenic
1195599066 X:106725958-106725980 TCCATTTCCCACTAACTGAAAGG - Intronic
1199099846 X:143786581-143786603 TACAGTTAATACTAGCAGAAGGG + Intergenic