ID: 1073174770

View in Genome Browser
Species Human (GRCh38)
Location 10:101548217-101548239
Sequence TCAACTAGGAGTAGACTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 499}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073174770 Original CRISPR TCAACTAGGAGTAGACTTGC TGG (reversed) Intronic
900277573 1:1841830-1841852 ATACCTAGGAGTAGAATTGCTGG - Intronic
902064754 1:13675529-13675551 TTATCTAGAAGTAGAATTGCTGG + Intergenic
904217751 1:28936924-28936946 GTAACTAGGAGTAGAATTGCTGG + Intronic
905264443 1:36741418-36741440 ATATCTAGGAGTAGAATTGCTGG + Intergenic
905842657 1:41197175-41197197 ATAACTAGGGGTAGAATTGCTGG - Intronic
906260278 1:44381896-44381918 CCTACTAGGAGTAGACGTGATGG - Intergenic
906304904 1:44711205-44711227 TTACCTAGGAGTGGAATTGCTGG + Intronic
906754387 1:48295218-48295240 ACATCTAGGAGTTGACTTGCTGG - Intergenic
906972141 1:50526693-50526715 ATAACTAGGAGTGGAATTGCTGG + Intronic
906986742 1:50691081-50691103 ATATCTAGGAGTAGAATTGCTGG + Intronic
907199341 1:52712853-52712875 ACACCTAGGAGTGGAATTGCTGG - Intergenic
907456208 1:54577671-54577693 ATAACTAGGAGTGGAATTGCTGG + Intronic
907498915 1:54864181-54864203 AGAACTAGGAGTGGAATTGCTGG - Intronic
907689555 1:56648564-56648586 ATAACTAGAAGTAGAATTGCTGG + Intronic
907801699 1:57772535-57772557 GCATCTAGGAGTAGACTCGCTGG + Intronic
908327828 1:63041183-63041205 TTACCTAGGAGTGGAATTGCTGG - Intergenic
908700935 1:66899120-66899142 ACACCTAGGAGTAGGATTGCTGG + Intronic
909631058 1:77770367-77770389 TTACCTAGGAGTAGAATTGCTGG + Intergenic
910199518 1:84684593-84684615 TTCACTAGGAGTGGACTTGCTGG - Intronic
910301290 1:85709638-85709660 ATAACTAGGAGTGGAATTGCTGG + Intergenic
910921532 1:92353204-92353226 ATACCTAGGAGTAGAATTGCTGG + Intronic
910937962 1:92502028-92502050 ATACCTAGGAGTAGAATTGCTGG - Intergenic
911155411 1:94631587-94631609 ATACCTAGGAGTAGAATTGCTGG + Intergenic
911695298 1:100883758-100883780 TTACCTAAGAGTAGAATTGCTGG + Intronic
913008288 1:114656748-114656770 TTATCTAGGAGTAGAATTGCTGG + Intronic
913458309 1:119056889-119056911 ATACCTAGGAGTAGAATTGCTGG + Intronic
914866777 1:151436856-151436878 ACAGCTAGGAGTAGAACTGCTGG + Intronic
915220180 1:154368339-154368361 TATACTAGGAGTAAAATTGCTGG + Intergenic
915238778 1:154504381-154504403 TTACCCAGGAGTGGACTTGCTGG + Intronic
916286985 1:163118429-163118451 ATATCTAGAAGTAGACTTGCTGG - Intronic
916350196 1:163840630-163840652 TTAACTATGAAAAGACTTGCTGG + Intergenic
916704862 1:167338925-167338947 ATACCTAGGAGTAGAATTGCTGG + Intronic
917113666 1:171579005-171579027 TAAAATTGGAGTAGAATTGCTGG + Intronic
917226791 1:172791947-172791969 ACACCTAGGAGTGGAGTTGCTGG + Intergenic
917301898 1:173583981-173584003 ATACCTAGGAGTAGAATTGCTGG - Intronic
917992152 1:180391782-180391804 ATACCTAGGAGTAGAATTGCTGG - Intronic
918392045 1:184075652-184075674 TCTACTAAGAGTAGATTAGCTGG + Intergenic
919345468 1:196370687-196370709 ATATCTAGGAGTAGAATTGCTGG - Intronic
919523410 1:198617641-198617663 TCACCTAAGAATAGAATTGCTGG - Intergenic
921404749 1:214766166-214766188 ATACCTAGGAGTAGAATTGCTGG + Intergenic
921671825 1:217933599-217933621 TCCACTGGTAGTAAACTTGCTGG + Intergenic
923357193 1:233170165-233170187 GTACCTAGGAGTAGAATTGCTGG + Intronic
924714035 1:246555643-246555665 ACAGCTAGAAGTAGAATTGCAGG - Intronic
1063557537 10:7095222-7095244 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1064772636 10:18739629-18739651 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1064805703 10:19129167-19129189 TGAAGTAGGGGTAGTCTTGCGGG - Intronic
1067844179 10:49706217-49706239 TATACTAGGAATAGAATTGCTGG - Intronic
1067904570 10:50277351-50277373 AAAACCAGGAGTAGACTTGATGG + Intergenic
1068375357 10:56170829-56170851 TCAGCTAAGTGAAGACTTGCAGG + Intergenic
1069730065 10:70605292-70605314 ATATCTAGGAGTGGACTTGCTGG + Intergenic
1069970422 10:72163249-72163271 ATACCTAGGAGTAGAATTGCTGG - Intronic
1070460650 10:76666087-76666109 ACATCTAGGAGTAGAAATGCTGG - Intergenic
1071419157 10:85472799-85472821 GCACCCAGGAGTAGACTTGCAGG - Intergenic
1071735739 10:88297845-88297867 ACATCTAGGAGTGGAATTGCTGG + Intronic
1072327260 10:94310867-94310889 TGAAGTAGGAGTAGTCTTGTGGG - Intronic
1072336085 10:94399713-94399735 ACACCTAGGAGTAAAATTGCTGG + Intergenic
1072462434 10:95631907-95631929 TCATCTAAGAGTGGAATTGCAGG - Intronic
1072582193 10:96749298-96749320 TTATCTAGGAGTGGACTGGCTGG - Intergenic
1073039647 10:100594382-100594404 ACACCTAGGAGTACACTTGCTGG - Intergenic
1073174770 10:101548217-101548239 TCAACTAGGAGTAGACTTGCTGG - Intronic
1073937914 10:108656863-108656885 TTACCTAGGAGCAGAATTGCTGG - Intergenic
1074654059 10:115562002-115562024 TCACCTAAGAGTGGAATTGCTGG - Intronic
1076418730 10:130312667-130312689 CCACCTAGGAGTGGAATTGCTGG - Intergenic
1078126942 11:8575229-8575251 ATACCTAGGAGTAGAATTGCTGG - Intronic
1078701824 11:13692395-13692417 TTACCTAGGAGTGGAATTGCTGG + Intronic
1078725638 11:13928349-13928371 GCACCTAGGAGTGGAATTGCTGG + Intergenic
1079007019 11:16798780-16798802 GCTCCTAGGAGTGGACTTGCTGG - Intronic
1079930537 11:26554439-26554461 TTACCTAGGAGTAGACTGGTTGG + Intronic
1080057449 11:27920928-27920950 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1080288908 11:30648743-30648765 TTATCTAGAAGTAGAATTGCTGG + Intergenic
1080325496 11:31067520-31067542 ATAACTAGGAGTGGAATTGCTGG - Intronic
1080448687 11:32360801-32360823 ATAACTAGGAGTGGAATTGCTGG + Intergenic
1081186541 11:40049572-40049594 CCAACAAGGAGTTGGCTTGCAGG - Intergenic
1083559382 11:63660543-63660565 ATACCTAGGAGTAGAATTGCTGG - Intronic
1084098632 11:66930382-66930404 TAAACTAGGAGTGGAGTTGCTGG - Intronic
1084746981 11:71178057-71178079 ATAACTAGGAGTGGAATTGCTGG - Intronic
1084896411 11:72273705-72273727 TAAGCTAGGAGTAGAATTGCTGG + Intergenic
1084896529 11:72275066-72275088 TAACCTAGGAGTAGAATTGTTGG + Intergenic
1085366904 11:75956267-75956289 ATACCTAGGAGTAGAATTGCTGG + Intronic
1086310889 11:85535612-85535634 ATATCTAGGAGTAGAATTGCTGG - Intronic
1086413367 11:86565358-86565380 ATACCTAGGAGCAGACTTGCTGG - Intronic
1087395699 11:97594298-97594320 ACAACTAGTAGTAGTATTGCTGG - Intergenic
1087803977 11:102535682-102535704 ACACCTGGGAGTAGAATTGCTGG + Intergenic
1088520670 11:110695797-110695819 GTACCTAGGAGTAGAATTGCAGG - Intronic
1090364600 11:126195416-126195438 CTAACTAGGAGTGGAATTGCTGG - Intergenic
1090466190 11:126936367-126936389 ACATCTAGGAGTGGAATTGCTGG - Intronic
1090542020 11:127716871-127716893 TCCAATAGAAGTTGACTTGCTGG + Intergenic
1090960507 11:131552360-131552382 TCAACCAGGAGTATAATTTCTGG - Intronic
1091617910 12:2063895-2063917 TTACCTAGGAGTGGAATTGCTGG + Intronic
1091724481 12:2836134-2836156 ACACCTAGGAGTGGAATTGCTGG + Intronic
1092102591 12:5898373-5898395 ACACCTAGGAGTGGAATTGCTGG - Intronic
1092210430 12:6642805-6642827 TTTCCTGGGAGTAGACTTGCTGG + Intronic
1092281145 12:7098444-7098466 ATACCTAGCAGTAGACTTGCTGG - Intronic
1092519804 12:9258094-9258116 TCATCTAGAAGTAGAGTTACAGG + Intergenic
1094101237 12:26766137-26766159 TCAACTAGGGGTAAAATTGCTGG + Intronic
1095416510 12:41983095-41983117 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1095808308 12:46344994-46345016 ACACCTAGGAGTGGAATTGCCGG - Intergenic
1095925213 12:47571563-47571585 TCACCTAGGATTGGAATTGCTGG + Intergenic
1097769234 12:63561791-63561813 ACACCTAGGAGTGGAATTGCTGG + Intronic
1097778550 12:63676133-63676155 ACACCTAGGAGTGGAATTGCTGG + Intergenic
1098039531 12:66340129-66340151 ATAACTAGGAGTAGAATTGATGG + Exonic
1098366501 12:69708999-69709021 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1098785941 12:74755799-74755821 GTACCTAGGAGTAGAATTGCTGG + Intergenic
1100049536 12:90430018-90430040 GAACCTAGGAGTAGACTTGGTGG + Intergenic
1100161868 12:91870236-91870258 ACACCTAGGGGTAGAATTGCTGG + Intergenic
1100621338 12:96277274-96277296 ACACCTAGGAGTGGAATTGCTGG - Intergenic
1100622122 12:96287534-96287556 ATACCTAGGAGTAGAATTGCTGG - Intronic
1101705785 12:107219828-107219850 ACACCTAGGAGTAGAATTGACGG + Intergenic
1102136034 12:110576357-110576379 ATACCTAGGAGTAGAATTGCTGG - Intronic
1102259113 12:111433015-111433037 ACATCTAGGAGTGGAATTGCTGG + Intronic
1102696666 12:114805099-114805121 TTACCTCGGAGTGGACTTGCTGG + Intergenic
1103677303 12:122666146-122666168 TTTCCTAGGAGTAGAATTGCCGG + Intergenic
1104075961 12:125390117-125390139 TTAGCTAGGAGTGGAATTGCTGG - Intronic
1104186297 12:126435268-126435290 CCACCTAGGAGTGGAATTGCTGG + Intergenic
1104234386 12:126918959-126918981 ACAACTAGGAGTAGAGTTACTGG + Intergenic
1105324068 13:19354231-19354253 AGAACTAGGAGTGGAATTGCTGG - Intergenic
1105630627 13:22161770-22161792 ATACCTAGGAGTAGAATTGCCGG + Intergenic
1105869208 13:24489160-24489182 AGAACTAGGAGTGGAATTGCTGG + Intronic
1106037359 13:26056045-26056067 TTACCTAGGAGTGGACCTGCAGG - Intergenic
1107005943 13:35611921-35611943 AGACCTAGGAGTAGAATTGCTGG + Intronic
1107157026 13:37179906-37179928 TCACCCAGGAGTTGATTTGCTGG + Intergenic
1107376096 13:39806301-39806323 TACACTAGAAGTAGAATTGCTGG - Intergenic
1107560996 13:41557265-41557287 TTAACTAGGAGTGGAATTCCTGG - Intergenic
1108015386 13:46069839-46069861 ACACCTAGGAGTAGAACTGCTGG + Intronic
1108038251 13:46314585-46314607 ATAACTAGGTATAGACTTGCGGG - Intergenic
1108366819 13:49724271-49724293 TCACCTAGGAGTAGAACTGCTGG + Intronic
1108459192 13:50648117-50648139 GTACCTAGGAGTAGAATTGCTGG + Intronic
1108683725 13:52801370-52801392 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1109218598 13:59617461-59617483 TCCACTAGGAGTGGACGTGCTGG - Intergenic
1109699139 13:66002565-66002587 TGAAGTAGGAGTAGAATTTCAGG - Intergenic
1110009887 13:70318768-70318790 ACACCTAGGAGTATAATTGCTGG + Intergenic
1110207672 13:72935554-72935576 ATATCTAGGAGTAGACTGGCCGG + Intronic
1110590621 13:77253250-77253272 ATACCTAGGAGTAGAATTGCTGG - Intronic
1111251020 13:85601278-85601300 TAAACTAGATGTAGAATTGCTGG + Intergenic
1112395368 13:99025681-99025703 GCATCTAGGAGTGGAATTGCTGG - Intronic
1112489693 13:99850655-99850677 ATACCTAGGAGTAGAATTGCTGG - Intronic
1113461187 13:110483382-110483404 TCATCTAGGAGTAGAACTTCTGG - Intronic
1114541614 14:23464526-23464548 ACATCTAGGAGTAGAGTTGCTGG - Intergenic
1115611778 14:35055404-35055426 ATAACTAGGACTAGAATTGCTGG + Intronic
1115671254 14:35614208-35614230 ATACCTAGGAGTAGAATTGCTGG - Intronic
1116151290 14:41145438-41145460 TCAACTTGGAGTGGGCCTGCAGG - Intergenic
1117220092 14:53595173-53595195 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1117416888 14:55505053-55505075 TCAGCTGGGAAAAGACTTGCTGG + Intergenic
1118035963 14:61866224-61866246 ATACCTAGGAGTTGACTTGCTGG + Intergenic
1118583373 14:67327272-67327294 ACACCTAGGAGTAGAATTGCCGG + Intronic
1119040564 14:71270524-71270546 ACAACTAGAAGTGGAATTGCAGG - Intergenic
1119109724 14:71960138-71960160 TCAGTTTGGAGTAGACTTGCAGG + Intronic
1119110998 14:71973813-71973835 TCCCCCAGGATTAGACTTGCTGG + Intronic
1119694587 14:76702642-76702664 TAACCTAGGAGTGGAGTTGCTGG - Intergenic
1120599461 14:86483639-86483661 TGACCTAGGAGTAAAATTGCTGG + Intergenic
1120806660 14:88758653-88758675 ACATCTAGGAATAGAATTGCTGG - Intronic
1120832603 14:89011234-89011256 ATAACTAGGAGTAGAATGGCTGG - Intergenic
1121609893 14:95270827-95270849 ACACCTAGGAGTAGAATTTCTGG + Intronic
1122166632 14:99830003-99830025 CTACCTAGGAGTAGAATTGCCGG + Intronic
1122805836 14:104256395-104256417 ATGACTAGGAGTAGAATTGCTGG + Intergenic
1124936379 15:34175893-34175915 TTATGTAGGAGTAGAGTTGCTGG - Intronic
1125700666 15:41680460-41680482 TCAACTAGGTGCAGTCTTGTTGG - Intronic
1125785724 15:42316091-42316113 ATATCTAGGAGTAGAATTGCTGG - Intronic
1125823990 15:42659859-42659881 ACACCTAAGAGTAGAATTGCTGG - Intronic
1126215494 15:46148495-46148517 GCAACTAGAAGTGGAATTGCTGG + Intergenic
1126605853 15:50475501-50475523 TTACCTAGGAGTAGAATTGCTGG - Intronic
1127490864 15:59461858-59461880 ATTACTAGGAGTAGAATTGCTGG + Intronic
1127738430 15:61870640-61870662 AAACCTAGGAGTAGAATTGCTGG + Intronic
1128048988 15:64646012-64646034 ATACCTAGGAGTAGAATTGCTGG - Intronic
1128473531 15:67976674-67976696 TGTACCAGGAGTAGAATTGCTGG + Intergenic
1129355722 15:74989904-74989926 ATACCTAGGAGTAGAATTGCAGG + Intronic
1129526532 15:76219960-76219982 ATAACTAGGAGTAGAATTGCTGG - Intronic
1129675068 15:77628192-77628214 ACAGCTAGGAGCAGAATTGCTGG - Intronic
1130176302 15:81574857-81574879 TTAACTAGCAGTAGACTTTGTGG + Intergenic
1130369237 15:83269706-83269728 ACAACTAGGAGTGGAATTTCTGG - Intronic
1131129930 15:89891867-89891889 ATACCTAGGAGTAGAATTGCTGG - Intronic
1131245251 15:90786381-90786403 ACACCTGGGAGTGGACTTGCTGG + Intronic
1131289775 15:91097585-91097607 GAAACTAGGAATAGAGTTGCTGG - Intergenic
1131334865 15:91539197-91539219 TCAACTAGAATTTGAATTGCTGG - Intergenic
1131464187 15:92642291-92642313 ACACCTAGGAGTGGAATTGCTGG - Intronic
1132055028 15:98644810-98644832 ATAACTAGGGCTAGACTTGCTGG + Intergenic
1132158586 15:99515188-99515210 ACACCTAGGAGTGGAATTGCTGG + Intergenic
1132494145 16:252512-252534 ACACCTAGGACTGGACTTGCTGG + Intronic
1133214184 16:4281119-4281141 TTACCTAGGAGTGGAATTGCTGG - Intergenic
1133891949 16:9887688-9887710 ATAACTAGGAGTAAAATTGCTGG + Intronic
1133948733 16:10371667-10371689 AAAACTAGGAGTAGAATTGGTGG + Intronic
1134421006 16:14089639-14089661 ACACCTAGGAGTGGAATTGCTGG + Intronic
1134430320 16:14198334-14198356 TCACCTAGGAGTAGAATTGCTGG + Intronic
1135143954 16:19945419-19945441 TCAAATAGGAGTGGATTTCCTGG + Intergenic
1135409568 16:22223191-22223213 GCACCTAGGAGTGGAATTGCTGG + Intronic
1136245377 16:28972821-28972843 TTACCTAGGAGTGGAATTGCTGG + Intergenic
1137730930 16:50689424-50689446 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1138050466 16:53771600-53771622 GTAACTAGGAGTGGAATTGCCGG - Intronic
1138080850 16:54090012-54090034 ACATCTAGGAGTGGAATTGCTGG - Intronic
1138367812 16:56496784-56496806 TAAACCAGGAATAGAATTGCTGG + Intronic
1138624653 16:58240759-58240781 TATACTAGGAGTAGAATTGGTGG + Intronic
1139496467 16:67323182-67323204 ACACCTAGGAGTGGAATTGCTGG - Intronic
1139624464 16:68174902-68174924 ACACTTAGGAGTAGAGTTGCTGG - Intronic
1140168005 16:72574425-72574447 TTATCTGGGAGTGGACTTGCTGG - Intergenic
1140256531 16:73341550-73341572 ACATCTAGGAGTAGAATTTCTGG - Intergenic
1140564807 16:76029312-76029334 ATACCTAGGAGTAGAGTTGCTGG - Intergenic
1140758008 16:78086120-78086142 ATAGCTAGGAGTAGAGTTGCTGG - Intergenic
1140960603 16:79908504-79908526 ACACCTAGAAGTAGAGTTGCTGG - Intergenic
1141188719 16:81808150-81808172 ACACCTAGGAGTGGAATTGCTGG + Intronic
1141325176 16:83050304-83050326 TCCCCTAGGAGTGGAATTGCTGG + Intronic
1141508945 16:84500315-84500337 ACACCTAGGAGTGGACTTGCTGG + Intronic
1141515534 16:84542294-84542316 TATCCTAGGAGTGGACTTGCTGG - Intronic
1142500318 17:328532-328554 GTAACTAGGAGTAGAGTTTCTGG - Intronic
1143221937 17:5269458-5269480 ATAACCAGGAGTAGAATTGCTGG - Intergenic
1143922585 17:10342426-10342448 GTACCTAGGAGTAGAGTTGCTGG - Intronic
1144024027 17:11261817-11261839 ATACCTAGGAGTAGATTTGCTGG + Intronic
1144730680 17:17524293-17524315 ACACCTAGGAGTGGAATTGCTGG + Intronic
1145019211 17:19416541-19416563 CCACCTAGGGGTAGACTTCCAGG - Exonic
1146690235 17:34869125-34869147 TCAACTAGGAGGAGACATAAAGG - Intergenic
1146779480 17:35655653-35655675 ATACCTAGGAGTAGAATTGCTGG + Intronic
1147422445 17:40328924-40328946 ATACCTAGGAGTAGAATTGCTGG + Intronic
1147931003 17:43981230-43981252 ACACCTAGGAGTTGAATTGCTGG + Intronic
1148162615 17:45459633-45459655 ATACTTAGGAGTAGACTTGCTGG + Intronic
1148430599 17:47640156-47640178 ATAGCTAGGAGTAGAGTTGCTGG - Intergenic
1148823336 17:50373720-50373742 ATACCTAGGAGTAGAATTGCTGG - Intronic
1148833395 17:50451285-50451307 ATAACTAGGAGTGGAATTGCTGG + Intronic
1149938072 17:60829656-60829678 GTAACTAGGAGTGGACTTGCTGG + Intronic
1149939432 17:60847342-60847364 ATACCTAGGAGTAGAATTGCTGG + Intronic
1150393843 17:64806298-64806320 ATACTTAGGAGTAGACTTGCTGG + Intergenic
1150627779 17:66853356-66853378 CCACCTAGGAGTAGAATTTCTGG + Intronic
1151448841 17:74184929-74184951 ACACCTAGGAGTAGAATTCCAGG + Intergenic
1152693140 17:81730423-81730445 TCACCTAGGAGTGGCATTGCTGG - Intergenic
1153108279 18:1553126-1553148 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1153845537 18:9046161-9046183 CTATCTAGGAGTGGACTTGCTGG - Intergenic
1153873561 18:9344237-9344259 ATACCTAGGAGTAGAATTGCTGG + Intronic
1153887752 18:9482202-9482224 ATACCTAGGAGTAGAATTGCTGG + Intronic
1153916167 18:9747367-9747389 ATACCTAGGAGTAGAATTGCTGG - Intronic
1154141795 18:11830605-11830627 ACACCTAGGAGTGGAATTGCTGG - Intronic
1154275795 18:12958860-12958882 ATACCTAGGAGTAGAATTGCTGG + Intronic
1155097998 18:22578502-22578524 TCCACTAGGAGTAGAATTGCTGG + Intergenic
1155326908 18:24673442-24673464 TTAACTAGGAGAATACGTGCTGG + Intergenic
1156356197 18:36343133-36343155 ATACCTAGGAGTAGAATTGCTGG - Intronic
1156377824 18:36530722-36530744 TTACCTAGGGGTAGAATTGCTGG + Intronic
1156421479 18:36958358-36958380 ATACCTAGGAGTAGAATTGCTGG + Intronic
1157602080 18:48899900-48899922 ATAACTAGGAGTGGAATTGCTGG - Intergenic
1157765804 18:50296550-50296572 ACAACTAGGGGTGGAATTGCTGG + Intergenic
1158163783 18:54516604-54516626 ACACCTAGGAGCAGAATTGCTGG + Intergenic
1158658357 18:59361298-59361320 GTAACTAGGAGTAGAGTTGCTGG + Intergenic
1159020626 18:63140277-63140299 TGTACTAGGAGTTGAATTGCTGG - Intronic
1161174175 19:2830513-2830535 AATACTAGGAGTAGAATTGCTGG + Intronic
1161736744 19:5996200-5996222 ACACCTTGGAGTGGACTTGCTGG - Intronic
1161753870 19:6117200-6117222 ACACCTAGGAGTGGAATTGCTGG - Intronic
1162535010 19:11258011-11258033 ACACCTTGGAGTAGAATTGCTGG - Intronic
1163673647 19:18644413-18644435 ACATCTAGGAGCAGAATTGCTGG + Intronic
1164980386 19:32609260-32609282 ACACCTAGGAGTATAATTGCTGG - Intronic
1165472669 19:36012346-36012368 TCAACTAGAGCTAGACTTGTTGG - Intronic
1165581324 19:36867015-36867037 TTACCTAGGAGTGGAATTGCTGG + Intronic
1165584393 19:36901004-36901026 CTACCTAGGAGTAGAATTGCTGG - Intronic
1166982839 19:46641438-46641460 ACACCTAGGAGTGGAATTGCTGG - Intergenic
1168631189 19:57957560-57957582 ACACCTAGGAGTGGACTTGCTGG + Intergenic
926024446 2:9528928-9528950 TATACTAGGAGCAGAATTGCTGG - Intronic
926212600 2:10882128-10882150 TCCTCTAGGAGTAGAATGGCTGG + Intergenic
926225345 2:10963139-10963161 TCACCGAGGAGTGGAATTGCTGG + Intergenic
927144353 2:20152248-20152270 ATAACTAGGAGTTGAATTGCTGG + Intergenic
928545004 2:32321458-32321480 TTACCAAGGAGTAGAATTGCTGG + Intergenic
929182111 2:39052802-39052824 AAACCTAGGAGTAGAATTGCTGG + Intronic
929341294 2:40821741-40821763 ATACCTAGGAGTAGAATTGCTGG - Intergenic
929343913 2:40857243-40857265 ACAACAAAGAGTAGAATTGCTGG - Intergenic
929442656 2:41977382-41977404 TAAACTAGGAGTACACATGAGGG + Intergenic
929690795 2:44071304-44071326 ACAACTAGGACTGGAATTGCTGG - Intergenic
929913246 2:46111823-46111845 ATACCTAGGAGTGGACTTGCTGG + Intronic
930724403 2:54668299-54668321 TCAACTAAGAGTAGGCATGAGGG - Intronic
931312427 2:61094959-61094981 TTACCTAGGAGTAGGATTGCTGG + Intronic
931409495 2:62015532-62015554 TATACTAGGAGTGGACTTGTTGG + Intronic
932101672 2:68906883-68906905 GCAAATTGGAGTAGACTTCCTGG + Intergenic
932815798 2:74860746-74860768 ACAACTAGGAGTGGAATTACTGG + Intronic
933571177 2:84014672-84014694 ATACCTAGGAGTAGAATTGCTGG - Intergenic
933982554 2:87564622-87564644 ACATCTAGGAGTATGCTTGCTGG - Intergenic
934098445 2:88628464-88628486 TCAACGAGGAGGAGACTGGCCGG + Intergenic
935004703 2:99061620-99061642 ATAACTAGGAGTGGAATTGCTGG - Intronic
935454173 2:103247049-103247071 ATATCTAGGATTAGACTTGCTGG + Intergenic
935552686 2:104475010-104475032 TCAACAGGGAATATACTTGCTGG + Intergenic
935554052 2:104487722-104487744 ATACCTAGGAGTAGAATTGCTGG - Intergenic
936052354 2:109234067-109234089 ACATTTAGGAGTAGAATTGCTGG + Intronic
936242997 2:110804448-110804470 ATACCTAGGAGTAGAATTGCTGG - Intronic
936311287 2:111386170-111386192 ACATCTAGGAGTATGCTTGCTGG + Intergenic
936575136 2:113646990-113647012 ATACCTAGGAGTAGATTTGCAGG - Intergenic
937020997 2:118655261-118655283 TACTCTAGGAGTAGAATTGCTGG - Intergenic
938007536 2:127800133-127800155 TTACCTAGGCGTAGAATTGCTGG - Intronic
938136082 2:128757855-128757877 ATACCTAGGAGTAGAATTGCTGG + Intergenic
938389753 2:130895434-130895456 ACATCTAGGAGCAGAATTGCTGG + Intronic
938452074 2:131430058-131430080 TCAACTAGGATTTGATTTACTGG + Intergenic
939455438 2:142429141-142429163 TTACCTAGGAGTAGAATAGCTGG - Intergenic
939821094 2:146957713-146957735 ACACCTAGGAGTAGAATTTCTGG - Intergenic
940137197 2:150451359-150451381 ATAACTAGAAGTAGAATTGCTGG + Intergenic
941416104 2:165223713-165223735 ATACCTAGGAGTAGAATTGCTGG + Intergenic
942550493 2:177110913-177110935 ATAACTAGGAGTGGAATTGCTGG - Intergenic
942969422 2:181939727-181939749 ACAGCTAGGAGTGGATTTGCTGG + Intergenic
946058810 2:216924035-216924057 ATAACTAGGAGTGGAATTGCTGG + Intergenic
946343587 2:219089217-219089239 GTACCTAGGAGTAGAATTGCTGG - Intronic
947687772 2:232105260-232105282 TCATATAGGAGTAGAATTGCTGG + Intronic
948885449 2:240880143-240880165 ATAACTAGGAGTGGAATTGCAGG + Intronic
948965661 2:241377865-241377887 ATACCTAGGAGTAGAATTGCTGG + Intronic
1168908323 20:1424705-1424727 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1169011443 20:2254335-2254357 ACACCTGGGAGTAGAATTGCTGG + Intergenic
1169798280 20:9489196-9489218 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1170323286 20:15126211-15126233 ACACCTAGGAATAGAATTGCTGG + Intronic
1170577127 20:17672651-17672673 ATACCTAGGAGTAGAATTGCAGG - Intronic
1170870096 20:20197763-20197785 TCAACTTGATGTAGACTTGGGGG + Intronic
1170896734 20:20421758-20421780 ACTTCTAGGAGTAGAATTGCTGG - Intronic
1172179527 20:32993019-32993041 ATAACTAGGAGTGGAATTGCTGG - Intronic
1172469993 20:35186045-35186067 TATACTAGGAGCGGACTTGCTGG - Intergenic
1172961277 20:38801927-38801949 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1172972028 20:38880825-38880847 ATACCTAGGAGTAGAATTGCTGG + Intronic
1173483743 20:43424620-43424642 ATATCTAGGAGTAGAATTGCAGG - Intergenic
1174211518 20:48882593-48882615 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1174464344 20:50705628-50705650 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1175459381 20:59140380-59140402 TCAACCAGGAGCAGACTCTCTGG - Intergenic
1175666165 20:60861767-60861789 CCAACAAGAAGTAGGCTTGCTGG + Intergenic
1176977387 21:15337787-15337809 ATAACTAGGAGTGGAATTGCTGG - Intergenic
1177297898 21:19201138-19201160 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1180994365 22:19958050-19958072 ACACCTAGGAGTAGAATTGCTGG + Intronic
1181488769 22:23248381-23248403 ATAACTAGGAGTAGAATTGCTGG + Intronic
1181659790 22:24336759-24336781 ATAATTAGGAGTAGAATTGCTGG - Intronic
1181723579 22:24795192-24795214 ATAACTAGAAGTAGAATTGCTGG - Intergenic
1181757586 22:25035377-25035399 ACATCTAGGAGTAGAATGGCTGG + Intronic
1181795734 22:25308111-25308133 TTACCTAGGAGTGGAATTGCTGG + Intergenic
1181836221 22:25611333-25611355 TTACCTAGGAGTGGAATTGCTGG + Intronic
1182405607 22:30126697-30126719 ATTACTAGGAGTAGAATTGCTGG + Intronic
1182890789 22:33817257-33817279 TCAAATATCAGTAGACTTGCAGG + Intronic
1183987410 22:41577138-41577160 GCCACTAGGAGCAGACTGGCTGG + Exonic
1184021229 22:41822815-41822837 CCAACTAGGACTAGCCTTGCAGG - Intronic
1185160631 22:49227100-49227122 ACACCTAGGAGTGGAATTGCTGG - Intergenic
1185249356 22:49791782-49791804 TCACCTCGGAGTGGACTTTCAGG + Intronic
1185425043 22:50763909-50763931 ATACCTAGGAGTAGATTTGCAGG + Intergenic
949902503 3:8828943-8828965 ATAGCTAGGAGTAGAATTGCTGG - Intronic
950260488 3:11540059-11540081 TTATCTAGGACTAGAATTGCTGG + Intronic
950271741 3:11621675-11621697 GTACCTAGGAGTAGAATTGCTGG + Intronic
950519541 3:13488765-13488787 ACACCTAGGAGTAGAATTACTGG + Intronic
950564095 3:13754967-13754989 ACACCTAGGAGTGGAATTGCTGG + Intergenic
950907098 3:16548953-16548975 ACACCTAGGAGTGGAATTGCTGG - Intergenic
951085217 3:18504665-18504687 AAACCTAGGAGTAGAATTGCTGG + Intergenic
951521410 3:23614296-23614318 TACCCTAGGAGTAGACTTGCTGG + Intergenic
952023169 3:29047699-29047721 ACTTCTAGGAGTAGAGTTGCTGG + Intergenic
953751698 3:45613844-45613866 ATACCTAGGAGTAGAATTGCTGG + Intronic
954125867 3:48528316-48528338 TACGCTAGGAGTAGAATTGCTGG - Intronic
954175002 3:48837577-48837599 TCTCATAGGAGTAGAATTGCTGG - Intronic
955452194 3:59081131-59081153 ATACCTAGGAGTAGAATTGCTGG + Intergenic
955567657 3:60266032-60266054 ATAACTAGGAGTGGAATTGCTGG - Intronic
955586022 3:60479050-60479072 TCAAAGAGGACTAGACTTGAGGG + Intronic
955608874 3:60736267-60736289 ATACCTAGGAGTAGACTTGCTGG - Intronic
955682531 3:61517301-61517323 TTACCTAGGAGTGGAATTGCTGG - Intergenic
956221533 3:66909201-66909223 ACATCTAGGAGCAGAATTGCTGG + Intergenic
956330941 3:68107280-68107302 TTCACTAGGACTAGAATTGCTGG - Intronic
956829691 3:73033919-73033941 ACACCTAGAAGTAGAATTGCTGG + Intronic
957647801 3:82955742-82955764 ATACCTAGGAGTAGAATTGCTGG + Intergenic
958587676 3:96111390-96111412 TTACCTAGGAGTGGAATTGCTGG + Intergenic
959032212 3:101312645-101312667 TTATCTAGGAGTAGAATTTCTGG - Intronic
959914808 3:111805111-111805133 ATATCTAGGAGTAGACTTGTTGG - Intronic
960880881 3:122343661-122343683 ATACCTAGGAGTAGAATTGCTGG + Intergenic
960921756 3:122754112-122754134 ATACCTAGGAGTAGAATTGCTGG - Intronic
961265764 3:125641182-125641204 ACACCTAGGAGTGGAATTGCTGG - Intergenic
961672070 3:128540692-128540714 CCACCTAGGAGTGGAATTGCTGG + Intergenic
961765797 3:129209761-129209783 ACACCTAGGAGTAGAATTGCTGG - Intergenic
962408302 3:135118902-135118924 TCACCTAGAAATAGAATTGCTGG + Intronic
963415431 3:144989868-144989890 TCAAGTAGGAGCAGTCTTGTTGG - Intergenic
964283489 3:155092481-155092503 ACACCTAGGAGTAGAATTGCTGG - Intronic
964700900 3:159564970-159564992 ATATCTAGGAGTAGAATTGCTGG + Intronic
965564186 3:170094042-170094064 TCACCTAGGAGTAGACAAGGTGG - Exonic
965657475 3:171003773-171003795 ATAACTAGGAATAGAATTGCTGG + Intronic
966300936 3:178479343-178479365 TGTAGTAGGAGTAGATTTGCTGG + Intronic
966450513 3:180054515-180054537 ATAATTAGGAGTAGAATTGCTGG - Intergenic
966706578 3:182923045-182923067 ATAACTAGGAGTAGAATTGCAGG + Intergenic
967127115 3:186434590-186434612 ACATCTAGGAGTGGAATTGCTGG + Intergenic
967309692 3:188094335-188094357 ACACCTAGGAGTGGAATTGCTGG + Intergenic
967680355 3:192355137-192355159 TTACCTAGAAGTAGAATTGCTGG - Intronic
967756443 3:193175396-193175418 TCATCTAGGACCAGAATTGCAGG - Intergenic
968709648 4:2104400-2104422 TGTACTAGGAGTGGAATTGCTGG + Intronic
968711506 4:2122800-2122822 ATACCTAGGAGTAGACATGCTGG - Intronic
972441121 4:39092984-39093006 TTACCTAGGAGTAGAACTGCTGG - Intronic
973954046 4:56045690-56045712 TTTTCTAGGAGTAGAATTGCTGG + Intergenic
976078640 4:81328913-81328935 ATAACTAGGAGTGGAATTGCTGG - Intergenic
976800427 4:88984917-88984939 ATAACTAGGAGTAGAATTGTTGG - Intronic
978150740 4:105431567-105431589 TCACCTAGGAATGGAATTGCTGG - Intronic
978265563 4:106820267-106820289 TTCTCTAGGAGTAGAATTGCTGG + Intergenic
979963030 4:127044136-127044158 TCAAAGAGGAGTCGGCTTGCAGG + Intergenic
979991070 4:127376205-127376227 TTACCTAGGAGTAGAATTGCTGG - Intergenic
980737280 4:136906827-136906849 ATACCTAGTAGTAGACTTGCTGG - Intergenic
981190736 4:141859462-141859484 TGAACCAGAAGTAGAATTGCTGG - Intergenic
981247086 4:142553519-142553541 TCAACTATGAGTTGACTAGCAGG - Intronic
982153556 4:152492394-152492416 ACACCTAGAAGTAGAATTGCTGG + Intronic
982222017 4:153132944-153132966 AAAACTAGGAGTAGAAATGCTGG + Intergenic
983921770 4:173353704-173353726 AGACCTAGGAGTAGAATTGCTGG - Intergenic
984640066 4:182154397-182154419 TCAAGTAGCACTAGACTAGCTGG + Intronic
984815903 4:183835876-183835898 ACACCTAGGAGTGGAATTGCTGG + Intergenic
987104965 5:14629533-14629555 ACATCTAGGAGTGGAATTGCTGG + Intergenic
990392078 5:55333722-55333744 AAATCTAGGAGTAGAATTGCTGG - Intronic
992703948 5:79369037-79369059 TTACCTAGGAGTAGAATTGCTGG - Intergenic
992993431 5:82308786-82308808 CCAACTAGGAGTAGAATGCCTGG + Intronic
993389567 5:87302052-87302074 ACACCTAGGATTAGAATTGCTGG + Intronic
993479973 5:88412579-88412601 TAAACCAGGTGTACACTTGCAGG - Intergenic
993607697 5:90014362-90014384 ACATCTAGGAATAGTCTTGCAGG + Intergenic
994471045 5:100207905-100207927 TTAACTAGGAGAACACTTGAAGG + Intergenic
995440059 5:112181490-112181512 ATACCTAGGAGTAGAATTGCTGG - Intronic
995577309 5:113552671-113552693 ACACCTAGGAGTGGAATTGCTGG + Intronic
996084693 5:119292492-119292514 ACATCTGGAAGTAGACTTGCTGG - Intronic
996154401 5:120080097-120080119 GCAACTAGCAGTATACTTGAGGG + Intergenic
996698052 5:126420714-126420736 ATACCTAGGAGTAGACTTGCTGG - Intronic
997125591 5:131223891-131223913 TCAACATGGAGGACACTTGCTGG - Intergenic
997131752 5:131283977-131283999 ATACCTAGGAGTAGAGTTGCTGG + Intronic
997151149 5:131496858-131496880 TTACCTAGGATTAGAATTGCTGG + Intronic
997513782 5:134470862-134470884 ACACCCAGGAGTAGAATTGCTGG + Intergenic
997861795 5:137424468-137424490 GTAACTAGGAGTGGAATTGCTGG - Intronic
997881235 5:137592368-137592390 ATACCTAGGAGTAGAATTGCTGG - Intronic
998429183 5:142055729-142055751 ACACCTAGGAGTAGAATTGCTGG - Intergenic
998437280 5:142122510-142122532 ATAACTAGGAGTGGAATTGCTGG + Intronic
999108163 5:149092134-149092156 AAAACTAGCAGTAGAGTTGCTGG - Intergenic
1000259214 5:159569866-159569888 ATAACTAGGAGTGGAATTGCTGG + Intergenic
1001359665 5:171069148-171069170 TCAAGTAGAAGTAGATTTCCTGG - Intronic
1002084255 5:176761763-176761785 ACATCTAGAAGTAGAATTGCTGG - Intergenic
1002095349 5:176827661-176827683 ACACCTAGGAGTGGAATTGCTGG + Intronic
1003027484 6:2568712-2568734 ACTACTAGGAGTACAATTGCTGG + Intergenic
1003151684 6:3557606-3557628 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1003364761 6:5461933-5461955 GCACCCAGGAGTAGAATTGCTGG + Intronic
1004640416 6:17509695-17509717 ACACCTAGGAGTGGAATTGCTGG - Intronic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1005961493 6:30696682-30696704 ACACCTAGGAGCAGAATTGCTGG + Intergenic
1006504867 6:34482631-34482653 ATACCTAGGAGTAGAATTGCTGG + Intronic
1007009684 6:38403708-38403730 ATAACTAGGAGTAGAATTGCTGG - Intronic
1007233857 6:40376453-40376475 GTACCTAGGAGTAGAATTGCGGG - Intergenic
1007524199 6:42477173-42477195 ATATCTAGGAGTAGACTTCCAGG + Intergenic
1007671320 6:43556648-43556670 ATAACTAGGAGTAGAATTGCTGG - Intronic
1008017305 6:46535143-46535165 ATACCTAGGAGTAGACTTTCTGG + Intergenic
1008169245 6:48181947-48181969 ATAACTAGGAGTGGAATTGCTGG - Intergenic
1008390182 6:50941394-50941416 ATACCTAGGAGTAGAGTTGCTGG - Intergenic
1009567651 6:65332010-65332032 TATACTAGAAGTAGAATTGCTGG + Intronic
1011023818 6:82844082-82844104 ATATCTAGGAGTAGAATTGCTGG + Intergenic
1012200197 6:96396557-96396579 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1012281554 6:97333450-97333472 TTACCTAGGAGTGGACTTGCTGG + Intergenic
1012295780 6:97521359-97521381 CTAACTAGGAGTAAAATTGCTGG - Intergenic
1013571984 6:111437217-111437239 ATACCTAGGAGTAGAATTGCTGG - Intronic
1014088749 6:117378153-117378175 ATACCTAGGAGTAGAATTGCTGG - Intronic
1015838301 6:137446320-137446342 ATATCTAGGAGTAGAATTGCTGG + Intergenic
1016091828 6:139988868-139988890 GTAACTAGGAGTAGAATTGCTGG + Intergenic
1016110222 6:140213849-140213871 ACAACTAGGAGTGGAACTGCTGG + Intergenic
1016230243 6:141795134-141795156 ATACCTAGGAGTAGAATTGCAGG - Intergenic
1016902940 6:149119791-149119813 AAACCTAGGAGTAGAATTGCTGG - Intergenic
1017132083 6:151116255-151116277 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1017678781 6:156842621-156842643 ATACCTAGGAGTAGAATTGCTGG + Intronic
1018306295 6:162459995-162460017 TAGCCTAGGAGTAGAATTGCAGG - Intronic
1021527339 7:21603415-21603437 ACACCTAGGAGTGGAATTGCTGG + Intronic
1021640331 7:22730184-22730206 ACAGCAGGGAGTAGACTTGCTGG + Intronic
1022387302 7:29913915-29913937 TCCACTTTGAGTAGACTTGCAGG - Intronic
1022435799 7:30383692-30383714 ATACCTAGGAGTAGATTTGCTGG + Intronic
1022566048 7:31402828-31402850 ACAGCTAGGAGTGGAATTGCTGG + Intergenic
1022857996 7:34335124-34335146 GTAACTAGGAGTAGAATTGCTGG + Intergenic
1022928505 7:35082869-35082891 ACACCTAGGAGTGGAATTGCTGG + Intergenic
1022937481 7:35193798-35193820 ACACCTAGGAGTGGAATTGCTGG + Intergenic
1023124248 7:36939495-36939517 TCTACTCTGTGTAGACTTGCTGG - Intronic
1023420342 7:39972810-39972832 ATATCTAGGAGTAGAATTGCTGG + Intronic
1024999645 7:55304568-55304590 ACACCTACGAGTAGAATTGCTGG + Intergenic
1026554624 7:71395597-71395619 ATATCTAGGAGTAGAATTGCTGG + Intronic
1028072149 7:86463888-86463910 TTTACTAGCAGTAGAATTGCTGG - Intergenic
1028372647 7:90111801-90111823 ACATCTAGGAGTGGAATTGCTGG - Intergenic
1028555678 7:92121450-92121472 ATACCTAGGAGTAGAATTGCTGG - Intronic
1029067238 7:97863114-97863136 ATATCTAGGAGTAGAATTGCTGG - Intronic
1029792249 7:102856871-102856893 AAACCTAGGAGTAGAATTGCTGG - Intronic
1029824617 7:103176543-103176565 ACACCTAGGAGTGGAATTGCTGG + Intergenic
1029833642 7:103286441-103286463 ACACCTAGGAGTGGAATTGCTGG + Intergenic
1030676156 7:112388024-112388046 ATATCTAGGAGTAGACTTGCTGG - Intergenic
1031019411 7:116611118-116611140 ATATCTAGGAGTAGAATTGCTGG + Intergenic
1031135152 7:117875767-117875789 TCCACCAGGAGGACACTTGCTGG + Intergenic
1031915308 7:127557424-127557446 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1032025371 7:128437527-128437549 ACAACTAGGAGTAGAACTGCTGG - Intergenic
1032152448 7:129441347-129441369 ATATCTAGGAGTAGACTTGTTGG - Intronic
1032308868 7:130763414-130763436 GGACCTAGGAGTAGAATTGCTGG + Intergenic
1033335185 7:140446288-140446310 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1033336557 7:140458150-140458172 TTACCTAGGAGTGGAATTGCTGG - Intronic
1033383346 7:140846139-140846161 TATACCAGGAGTAGAATTGCAGG - Intronic
1034477343 7:151293293-151293315 TCATTTAGGAGTAGAATGGCTGG - Intergenic
1034949313 7:155286251-155286273 ACACCCAGAAGTAGACTTGCTGG + Intergenic
1035723482 8:1810863-1810885 ACACCTAGGAGTAGAGTTTCTGG + Intergenic
1036504586 8:9343852-9343874 TCAGCTAGGACTTCACTTGCAGG - Intergenic
1037244721 8:16820033-16820055 TTACCTAGGAATAGAATTGCTGG - Intergenic
1037399557 8:18480710-18480732 TAAACTAGAAGTAAAATTGCTGG + Intergenic
1037408891 8:18573135-18573157 TTACTTAGGAGTAGAATTGCTGG - Intronic
1037652885 8:20855780-20855802 ACACCTAGGAGTAGAATTGCTGG + Intergenic
1037798201 8:22014610-22014632 ACATCTAGGAGTGGAATTGCTGG - Intergenic
1039084541 8:33766966-33766988 ATATCTAGGAGTAGAATTGCTGG - Intergenic
1040697446 8:50018955-50018977 ATACCTAGGAGTAGATTTGCTGG - Intronic
1040844032 8:51816929-51816951 ACATCTAGGAGTAGAATTACTGG - Intergenic
1041041168 8:53847492-53847514 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1041308790 8:56492555-56492577 ACACCTGGGAGTAGAGTTGCAGG + Intergenic
1041820455 8:62026647-62026669 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1045175385 8:99718036-99718058 ATAACTAGGAGTGGAATTGCCGG + Intronic
1045735153 8:105287034-105287056 AGTACTAGGAGTAGAATTGCTGG + Intronic
1047755411 8:127914442-127914464 ACACCTAGGAGTGGAATTGCTGG - Intergenic
1047878178 8:129163716-129163738 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1048148102 8:131865207-131865229 TGAACTAGGATTAGATTTGGAGG + Intergenic
1048748211 8:137639916-137639938 TCATCTAGTAGTGGAATTGCTGG + Intergenic
1049101732 8:140584466-140584488 ATACCTAGGAGTAGAATTGCTGG - Intronic
1049590844 8:143461487-143461509 ACACCTAGGAGTGGAATTGCAGG - Intronic
1050279000 9:4031125-4031147 ACATCTAGGAGTAGAATTGTCGG - Intronic
1050281280 9:4052835-4052857 ATACCTAGGAGTAGAATTGCTGG + Intronic
1050300820 9:4256600-4256622 TGATCTAGGAGTAGAATTACTGG - Intronic
1050859200 9:10403596-10403618 TCATCTAGGAGCTCACTTGCTGG - Intronic
1052339219 9:27348899-27348921 ACAATTAGGCCTAGACTTGCAGG + Intronic
1052845871 9:33336046-33336068 ATACCTAGGAGTAGAATTGCTGG + Intronic
1053265917 9:36713483-36713505 ACACCTAGGAGTGGAATTGCTGG + Intergenic
1055385016 9:75752015-75752037 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1055579566 9:77693279-77693301 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1056001664 9:82223743-82223765 ATAACCAGGAGTAGAATTGCTGG - Intergenic
1056123267 9:83510507-83510529 TCTTCTAGGAGTGGAATTGCTGG - Intronic
1056187031 9:84145368-84145390 ATATCTAGGAGTAGAGTTGCTGG - Intergenic
1057283433 9:93728620-93728642 TCACCCAGGAGTGGAATTGCTGG - Intergenic
1057479401 9:95432795-95432817 ACACCTAGGAGTGGAGTTGCTGG - Intergenic
1057574394 9:96230278-96230300 TTACCTAGGAGTAGAATCGCTGG - Intergenic
1057605626 9:96496278-96496300 TCCACAAGGACTAGACCTGCGGG - Intronic
1057771899 9:97975583-97975605 TTGCCTAGGAGTAGAATTGCTGG + Intergenic
1057813618 9:98277649-98277671 ATAACTAGGAGTGGAATTGCTGG - Intergenic
1058964665 9:110025549-110025571 GTACCTAGGAGTAGAATTGCTGG + Intronic
1060775683 9:126372384-126372406 ATACCTAGGAGTAGAATTGCTGG + Intronic
1060902220 9:127269428-127269450 TTAACTAGGAGTGGAATTGCCGG + Intronic
1061220891 9:129251131-129251153 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1185887351 X:3794710-3794732 ACAAATACGAGTAGGCTTGCTGG + Intergenic
1186807948 X:13159031-13159053 ATATCTAGGAGTAGAATTGCTGG + Intergenic
1186891591 X:13964329-13964351 ACACCTAGGAGTAGAATTGCTGG + Intergenic
1186986744 X:15024647-15024669 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1188471628 X:30546731-30546753 ACACCTAGGAGTTGAATTGCTGG - Intergenic
1188991460 X:36825751-36825773 ACACCTAGTAGTAGAATTGCTGG - Intergenic
1189378628 X:40485422-40485444 TTACCTAGGAGTAGAACTGCTGG - Intergenic
1189434322 X:40977913-40977935 CCATCTAGGAGTAGAATTGTTGG + Intergenic
1190155103 X:47984395-47984417 GTACCTAGGAGTAGAATTGCTGG - Intronic
1190159834 X:48023386-48023408 ATAACTAGGAGTGGAATTGCTGG + Intronic
1192037272 X:67577488-67577510 ACACCTAGGAGTGGAATTGCTGG + Intronic
1192090435 X:68149775-68149797 ATAACTAGGAGTAGAATTACAGG - Intronic
1192413639 X:70957632-70957654 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1192601697 X:72471349-72471371 ATACCTAGGAGTAGAATTGCTGG + Intronic
1192891498 X:75396620-75396642 ATAACTAGGAGTAGAATTGCTGG - Intronic
1193135398 X:77965634-77965656 ATACCTAAGAGTAGACTTGCTGG - Intronic
1193149274 X:78107746-78107768 ACACCTAGGAGTGGAATTGCTGG + Intronic
1193689240 X:84620317-84620339 ATATCTAGGAGTAGAATTGCTGG + Intergenic
1195492862 X:105493276-105493298 ATACCTAGGAGTAGAATTGCTGG + Intronic
1195714160 X:107802314-107802336 ATAACTAGGAGTAGAATTGCTGG - Intergenic
1195743980 X:108095551-108095573 TTAACTAGGAGTGGAATTGCTGG + Intronic
1195902107 X:109809893-109809915 GTACCTAGGAGTAGAGTTGCTGG - Intergenic
1196064740 X:111451286-111451308 ATAGCTAGGAGTAGAATTGCTGG - Intergenic
1196145842 X:112315949-112315971 TATACTAGGAGAAGAATTGCTGG + Intergenic
1196181184 X:112691572-112691594 ATACCTAGAAGTAGACTTGCTGG - Intergenic
1196617484 X:117784262-117784284 TTACCTAGGAGTAGCATTGCTGG - Intergenic
1196716409 X:118815317-118815339 TCACCTGGGAATAGAATTGCTGG + Intergenic
1196790693 X:119461600-119461622 TCACCTAGGAGTGGAATTACTGG - Intergenic
1197035146 X:121864640-121864662 ACAACTAAGAGTGGAATTGCTGG + Intergenic
1197171379 X:123438472-123438494 ACACCTAGGAGTAAAATTGCTGG + Intronic
1197520794 X:127494012-127494034 ATAACTAGGAGTAGGATTGCTGG - Intergenic
1197621488 X:128755383-128755405 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1197857994 X:130938242-130938264 TTATCTAGGAGTAGAGTTGTTGG - Intergenic
1198133692 X:133725564-133725586 TCATCTTGGAGTTGACTTACAGG + Intronic
1198221654 X:134608159-134608181 GTATCTAGGAATAGACTTGCTGG - Intronic
1199451593 X:147983255-147983277 TTCTCTAGGAGTAGAATTGCTGG + Intronic
1200096193 X:153664532-153664554 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1200288809 X:154851402-154851424 ACACCCAGGAGTAGAATTGCTGG + Intronic
1200757584 Y:7004732-7004754 TAACCTAGAAGTGGACTTGCTGG + Intronic
1202580914 Y:26379597-26379619 ACACCTAGGAGTAGAATTGCTGG + Intergenic