ID: 1073176401

View in Genome Browser
Species Human (GRCh38)
Location 10:101560074-101560096
Sequence CTGTGGGGCTGCAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073176401_1073176416 28 Left 1073176401 10:101560074-101560096 CCCCCTTCCCTGCAGCCCCACAG No data
Right 1073176416 10:101560125-101560147 ATGAGATTGCAGTAAGTAGTTGG No data
1073176401_1073176417 29 Left 1073176401 10:101560074-101560096 CCCCCTTCCCTGCAGCCCCACAG No data
Right 1073176417 10:101560126-101560148 TGAGATTGCAGTAAGTAGTTGGG No data
1073176401_1073176412 2 Left 1073176401 10:101560074-101560096 CCCCCTTCCCTGCAGCCCCACAG No data
Right 1073176412 10:101560099-101560121 CTGGCCAGTCTTGAGTTGGCCGG No data
1073176401_1073176418 30 Left 1073176401 10:101560074-101560096 CCCCCTTCCCTGCAGCCCCACAG No data
Right 1073176418 10:101560127-101560149 GAGATTGCAGTAAGTAGTTGGGG No data
1073176401_1073176411 -2 Left 1073176401 10:101560074-101560096 CCCCCTTCCCTGCAGCCCCACAG No data
Right 1073176411 10:101560095-101560117 AGCTCTGGCCAGTCTTGAGTTGG No data
1073176401_1073176413 3 Left 1073176401 10:101560074-101560096 CCCCCTTCCCTGCAGCCCCACAG No data
Right 1073176413 10:101560100-101560122 TGGCCAGTCTTGAGTTGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073176401 Original CRISPR CTGTGGGGCTGCAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr