ID: 1073178076

View in Genome Browser
Species Human (GRCh38)
Location 10:101568731-101568753
Sequence CTTCATCTGCAAAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073178070_1073178076 5 Left 1073178070 10:101568703-101568725 CCTCCCTGGCTTCTCTCAGCTCA No data
Right 1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG No data
1073178069_1073178076 17 Left 1073178069 10:101568691-101568713 CCAGTCTCAGCTCCTCCCTGGCT No data
Right 1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG No data
1073178071_1073178076 2 Left 1073178071 10:101568706-101568728 CCCTGGCTTCTCTCAGCTCAAAC No data
Right 1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG No data
1073178072_1073178076 1 Left 1073178072 10:101568707-101568729 CCTGGCTTCTCTCAGCTCAAACT No data
Right 1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073178076 Original CRISPR CTTCATCTGCAAAATGGGGA TGG Intergenic
No off target data available for this crispr