ID: 1073178113

View in Genome Browser
Species Human (GRCh38)
Location 10:101568901-101568923
Sequence GGTGATCTCAAACAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073178096_1073178113 21 Left 1073178096 10:101568857-101568879 CCCTGCGGTGTTGAAAGTGGATG No data
Right 1073178113 10:101568901-101568923 GGTGATCTCAAACAAGGGGAGGG No data
1073178106_1073178113 -8 Left 1073178106 10:101568886-101568908 CCAGGGGATGACCCAGGTGATCT No data
Right 1073178113 10:101568901-101568923 GGTGATCTCAAACAAGGGGAGGG No data
1073178097_1073178113 20 Left 1073178097 10:101568858-101568880 CCTGCGGTGTTGAAAGTGGATGA No data
Right 1073178113 10:101568901-101568923 GGTGATCTCAAACAAGGGGAGGG No data
1073178105_1073178113 -7 Left 1073178105 10:101568885-101568907 CCCAGGGGATGACCCAGGTGATC No data
Right 1073178113 10:101568901-101568923 GGTGATCTCAAACAAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073178113 Original CRISPR GGTGATCTCAAACAAGGGGA GGG Intergenic
No off target data available for this crispr