ID: 1073180406

View in Genome Browser
Species Human (GRCh38)
Location 10:101579810-101579832
Sequence GAGGAACCCTGGCCCAACAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073180399_1073180406 29 Left 1073180399 10:101579758-101579780 CCAAGTACTTCTGTTGCTGACCA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1073180406 10:101579810-101579832 GAGGAACCCTGGCCCAACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 172
1073180402_1073180406 2 Left 1073180402 10:101579785-101579807 CCTCTTGGCTCACCAAGTCATCT 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1073180406 10:101579810-101579832 GAGGAACCCTGGCCCAACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 172
1073180401_1073180406 9 Left 1073180401 10:101579778-101579800 CCATTCTCCTCTTGGCTCACCAA 0: 1
1: 0
2: 0
3: 23
4: 269
Right 1073180406 10:101579810-101579832 GAGGAACCCTGGCCCAACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 172
1073180404_1073180406 -10 Left 1073180404 10:101579797-101579819 CCAAGTCATCTGTGAGGAACCCT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1073180406 10:101579810-101579832 GAGGAACCCTGGCCCAACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 172
1073180398_1073180406 30 Left 1073180398 10:101579757-101579779 CCCAAGTACTTCTGTTGCTGACC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1073180406 10:101579810-101579832 GAGGAACCCTGGCCCAACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073180406 Original CRISPR GAGGAACCCTGGCCCAACAG AGG Exonic