ID: 1073181283

View in Genome Browser
Species Human (GRCh38)
Location 10:101585021-101585043
Sequence AGTCAGACCTAAGAATGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073181274_1073181283 23 Left 1073181274 10:101584975-101584997 CCTTAAAGGTGGGGGTCATCTTC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1073181283 10:101585021-101585043 AGTCAGACCTAAGAATGAGGCGG 0: 1
1: 0
2: 0
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073181283 Original CRISPR AGTCAGACCTAAGAATGAGG CGG Intronic
900761195 1:4472274-4472296 AGTCAGCCCAGAGAATCAGGAGG - Intergenic
901101510 1:6722663-6722685 AGACATACCTGAGAGTGAGGAGG - Intergenic
901867991 1:12120019-12120041 GTTCAGAACTAAGAAGGAGGTGG - Intronic
906559547 1:46746152-46746174 AACCAGACCTAAGATTCAGGGGG + Intergenic
910928126 1:92417062-92417084 AGTCAGTCGTACCAATGAGGGGG + Intergenic
911409506 1:97484578-97484600 AGTCAGAGCGAATAAAGAGGAGG - Intronic
916044442 1:160988688-160988710 AATCAGACCTAAGAATTACAAGG - Intergenic
916418492 1:164614422-164614444 GGTCCGACCTAAGAAAAAGGAGG - Intronic
917458577 1:175207396-175207418 AGTAAGCCCTAAGAGTTAGGTGG - Intergenic
920174512 1:204091877-204091899 AGCCAAAGCTAAGAAAGAGGTGG - Intronic
1065772615 10:29091690-29091712 ACTCAGATTTCAGAATGAGGGGG + Intergenic
1066513417 10:36127958-36127980 AGTCAGAATAAAGACTGAGGAGG + Intergenic
1067693971 10:48522420-48522442 GGACAGACCTAAGCAAGAGGAGG + Intronic
1073181283 10:101585021-101585043 AGTCAGACCTAAGAATGAGGCGG + Intronic
1074857297 10:117482816-117482838 AGCCAGTCGAAAGAATGAGGTGG + Intergenic
1075724088 10:124602946-124602968 TCTCAGAGCTAAGAGTGAGGTGG - Intronic
1080251939 11:30243419-30243441 AGTCAGAACTAAGAATTTAGTGG + Intergenic
1080434059 11:32223638-32223660 AGTCAGTGCTGGGAATGAGGAGG - Intergenic
1080961032 11:37160610-37160632 ATTCTTACCTAAGAATGAGAAGG + Intergenic
1083923478 11:65792636-65792658 AATCAACCCTAGGAATGAGGTGG + Intronic
1084063657 11:66691262-66691284 GGTCTGACCCAAGCATGAGGAGG - Exonic
1087890581 11:103533285-103533307 AGTCAGAAGCCAGAATGAGGAGG - Intergenic
1088735378 11:112724103-112724125 AGACAGAGATAAGAATGCGGTGG - Intergenic
1088982733 11:114878250-114878272 AGTCAGAGAAAATAATGAGGAGG + Intergenic
1091690730 12:2595721-2595743 AGTAAGACTTCAGAATGAAGAGG + Intronic
1091999586 12:5021261-5021283 AGTCGGATCAAAGAATGAGGCGG - Intergenic
1098907916 12:76180554-76180576 AGACTGACCTAAGACAGAGGAGG + Intergenic
1100309818 12:93383886-93383908 AGTGACCCCTAAGAATGAAGAGG - Intronic
1103174778 12:118853381-118853403 AGTCAAACCAAAGAAAAAGGTGG + Intergenic
1105939556 13:25135234-25135256 AATAAGACCTCAGAATGTGGTGG - Intergenic
1107713862 13:43179470-43179492 AGTCTGACCTGAGAAAGATGTGG - Intergenic
1109584107 13:64375296-64375318 AGTCAGACTGAGGAGTGAGGAGG + Intergenic
1111016799 13:82392465-82392487 AGCCAGACATAAGCAGGAGGGGG + Intergenic
1111078349 13:83268480-83268502 ATTCAGACCTAAGCATGGTGTGG - Intergenic
1113069164 13:106402848-106402870 GGTCATAGCTGAGAATGAGGAGG - Intergenic
1113430162 13:110243116-110243138 TGTCAGACCTAAGACCGTGGAGG + Intronic
1115258398 14:31427181-31427203 AGCCAGAGCTAGGACTGAGGAGG + Intronic
1117324870 14:54659688-54659710 TGTGAAACCTAAAAATGAGGGGG + Intronic
1118844737 14:69539088-69539110 AATCAGACCTAACAAGGAGTTGG + Intergenic
1127358391 15:58223742-58223764 AGGCAGACCTGAGTATGAGGGGG - Intronic
1127498718 15:59536497-59536519 TGTCACACCTAAGAATGAGCAGG - Intergenic
1129303704 15:74642763-74642785 AGAGAGCCCTCAGAATGAGGGGG - Intronic
1129783105 15:78287697-78287719 AGTCAGGACTAAAAATGATGGGG + Intronic
1130071337 15:80648860-80648882 AGTCAGACCTAGACATGATGAGG - Intergenic
1130189666 15:81721632-81721654 AATTAGACCTAAGAATTACGAGG + Intergenic
1132344935 15:101102419-101102441 GGTCAGACCTGAGCAAGAGGAGG + Intergenic
1133969010 16:10553690-10553712 AGGCAGCCCAAGGAATGAGGTGG - Intronic
1134172378 16:11978140-11978162 GGACAGTCCTAATAATGAGGGGG + Intronic
1136518217 16:30780600-30780622 GGTGAGACCTGAGAATGTGGTGG + Exonic
1137500795 16:49010501-49010523 AGTGTGACCTGGGAATGAGGAGG - Intergenic
1138552364 16:57754717-57754739 AGGCAGACCTAAGGTTGAGTTGG + Intronic
1143701925 17:8666930-8666952 AGTCAGACTCCAGACTGAGGAGG - Intergenic
1144863927 17:18323019-18323041 AGTCAAACCTGAGCATGGGGTGG - Exonic
1148250886 17:46079006-46079028 AGTCAGAAGTCAGAATGAAGAGG + Intronic
1148949047 17:51292820-51292842 AGCCAGACGTAAGTATGAGGAGG - Intronic
1151320310 17:73348840-73348862 AGGCAGACCCAGGAAGGAGGAGG - Intronic
1152487423 17:80603277-80603299 AGTGAGAGCTCAGAATGAGGAGG + Intronic
1152744871 17:82033994-82034016 AGCCACACCCCAGAATGAGGCGG - Exonic
1156286589 18:35702377-35702399 AGTCAGTCATCAGAATTAGGAGG - Intronic
1156698108 18:39792302-39792324 AATCAGAATTAAGAATGAGTTGG - Intergenic
1157032309 18:43926500-43926522 AGTTATACCTTAGAATGAAGTGG + Intergenic
1157159656 18:45301910-45301932 GGTCTGACCTAAAAAAGAGGAGG - Intronic
1157883722 18:51346234-51346256 AGTAAATCATAAGAATGAGGAGG - Intergenic
1159631751 18:70756801-70756823 CTTCAGACTGAAGAATGAGGAGG - Intergenic
1160295081 18:77630331-77630353 AGTCAGACATAAGCATCTGGGGG + Intergenic
1164485970 19:28656038-28656060 AGTCAGACCAAAGAATAAAAAGG + Intergenic
1165442929 19:35841082-35841104 ATGCAGACGTAAGAATGAAGAGG + Intronic
1165565778 19:36726505-36726527 AGTCACACCTAACCGTGAGGAGG - Intronic
1166938952 19:46351493-46351515 AGGCAGAGCTCAGAAAGAGGAGG + Intronic
1167883388 19:52481056-52481078 AGTCACACACATGAATGAGGGGG - Intronic
925799984 2:7589395-7589417 AGTCAGACCTACAGATGTGGAGG - Intergenic
931952995 2:67386019-67386041 CTTCAGACCTAAGAAGAAGGTGG - Intergenic
933616736 2:84489646-84489668 AATCAGCCTTAAGAATAAGGAGG - Intergenic
933741000 2:85533828-85533850 AATCAGACCTAAAGAGGAGGTGG - Intergenic
936479693 2:112874575-112874597 AGTCCCACCTGAGCATGAGGTGG - Intergenic
940142485 2:150508488-150508510 AGTCAGACATAGGGGTGAGGTGG + Intronic
941236274 2:162978537-162978559 AATCAGACATAAAAATGAGAAGG - Intergenic
941827550 2:169916916-169916938 AGTCAGAGCTCAGACTGAGGAGG - Intronic
943985806 2:194616598-194616620 AGGCAGACCTAAGAAGAGGGAGG + Intergenic
945412573 2:209529053-209529075 AGTCTGAACTAAGAATAAGGAGG + Intronic
945767131 2:213995151-213995173 AGCCTGACATAAGAATGATGAGG + Intronic
945800719 2:214426355-214426377 AGTTAGAAATAAGAGTGAGGCGG + Intronic
1169953157 20:11070762-11070784 AGTGAGGCCAAGGAATGAGGTGG - Intergenic
1172315085 20:33947552-33947574 ACTCAGACCTTAGAGTGAGTAGG - Intergenic
1172785378 20:37465003-37465025 AGCCAGGCCTGAGAAGGAGGGGG - Intergenic
1173892061 20:46520415-46520437 AGTCAGGCCTATGAATGACATGG + Intergenic
1176911649 21:14572497-14572519 AGTCAGGACTAAGAGTTAGGAGG + Intronic
1179563253 21:42230486-42230508 AGTCACACCTAAGGGTGAGGAGG - Intronic
1181456523 22:23063135-23063157 GAGCAGACCTAAGAATGATGGGG + Intronic
1184489959 22:44802760-44802782 AGGCAGAGATAGGAATGAGGTGG - Intronic
1184893242 22:47392071-47392093 GGTCAGGCCTGGGAATGAGGTGG - Intergenic
951709766 3:25576145-25576167 AGGCAGAGCTAAGTTTGAGGAGG + Intronic
952750643 3:36822085-36822107 ACTCAGGCCCATGAATGAGGTGG + Intergenic
956929285 3:74024467-74024489 AGTCAGACCTAAGGGTCAGGTGG + Intergenic
957301473 3:78397356-78397378 AATCAGTCCTAAGACTGTGGGGG + Intergenic
961097697 3:124172014-124172036 AGTCAGAACTAAGACTGAACTGG - Intronic
961352441 3:126312525-126312547 AGTCAGACATAAGAAACAGGAGG - Intergenic
963540357 3:146579892-146579914 AGTCAGAATGAAGAATGAAGAGG - Intronic
963579131 3:147101846-147101868 AGTCAGAAATCAGAATTAGGAGG + Intergenic
965449788 3:168823590-168823612 AGGCAGACCTCAGAATGTAGAGG + Intergenic
966129244 3:176617879-176617901 AGTAAGACCTAAGAAATAGTAGG - Intergenic
968249823 3:197198502-197198524 AGACAAACCAAACAATGAGGAGG + Intronic
970366952 4:15369151-15369173 AGTCAGAGGTAAGGATGAGAAGG + Intronic
973557224 4:52096174-52096196 ACTCATACTTCAGAATGAGGTGG - Exonic
974463761 4:62226049-62226071 AGTCAGACAAAAAAAAGAGGAGG - Intergenic
977821264 4:101474844-101474866 AGTCAGAGCCAAGAATGAAATGG - Intronic
979838973 4:125413425-125413447 AGTCACAACTCATAATGAGGGGG + Intronic
982597244 4:157402499-157402521 AGTCAGAACTAAGAATCTGCTGG + Intergenic
983102292 4:163639774-163639796 AGTAAGATCTAATAAGGAGGAGG + Intronic
983573836 4:169238815-169238837 AGACAGAGCTAAATATGAGGAGG - Intronic
984527909 4:180879530-180879552 AGGCAGACATCAGAATGATGTGG + Intergenic
985869110 5:2539757-2539779 AATAAGTCCTAAGAATGATGTGG + Intergenic
986030250 5:3886590-3886612 AGGCAGAAATAAGAATGAGGTGG - Intergenic
986219436 5:5754284-5754306 ACTCAGACCTCAGAATCAGATGG - Intergenic
987032959 5:13992365-13992387 AGATAGACATAAGAATGAGAAGG + Intergenic
988698006 5:33643349-33643371 CGTCAGGCCGAGGAATGAGGTGG - Intronic
989398041 5:40979559-40979581 AGTTGGACCTAGGAATGAAGGGG + Intronic
990070911 5:51781806-51781828 AGTCCTTCCTAAGATTGAGGGGG - Intergenic
990623139 5:57581955-57581977 AGCCAAACCAAAGAATGTGGGGG + Intergenic
992169409 5:74087141-74087163 AGTCTGACCTGAGAATGAGAAGG + Intergenic
997691789 5:135832252-135832274 ATTCACACCTAAGCATGAGAAGG + Intergenic
997696877 5:135868210-135868232 AATGAGACTTAAGAATGGGGAGG + Intronic
998895455 5:146794538-146794560 AGTCAGAACTAAAAAGGAAGTGG - Intronic
1007729541 6:43937583-43937605 AGTCAGAGCTGAGAAGCAGGCGG - Intergenic
1008524892 6:52397974-52397996 AGTGAGGCCTAAGAGGGAGGGGG + Intronic
1008806360 6:55433720-55433742 AGTCAAACATAAGAAGGAAGAGG + Intergenic
1010015653 6:71103027-71103049 GGTCAGACCTTATAATGAGCAGG - Intergenic
1010730832 6:79389369-79389391 TGTGAGAACTAAGAATGAGCAGG + Intergenic
1013384792 6:109615879-109615901 AGTCACACCTAAGAATGTAGGGG + Intronic
1014122752 6:117745341-117745363 AGTCTGTCCAAAGAATGACGTGG + Intergenic
1021003099 7:15358493-15358515 AGTCAGAACTGTGAATTAGGAGG + Intronic
1026187794 7:68096050-68096072 ACTCAGACCTAAGAAAAAGATGG + Intergenic
1027781393 7:82524831-82524853 AGTCAGATCCAAGAAGGAAGAGG + Intergenic
1028359947 7:89955684-89955706 GGTCACACCTATGAAAGAGGTGG + Intergenic
1029860083 7:103561702-103561724 GGTCACACCTAAGAAAGAGAGGG + Exonic
1031213986 7:118867340-118867362 AGTTACAGCTAAGAAAGAGGAGG - Intergenic
1035764194 8:2092413-2092435 GGACCGACCTAAGCATGAGGAGG + Exonic
1037717617 8:21413085-21413107 TGTCAGAGCTTAAAATGAGGTGG + Intergenic
1038502708 8:28059151-28059173 AGTCAGACCTAAGCTTCAGTGGG + Intronic
1039485852 8:37909232-37909254 AGAAAGACCTGAGAAGGAGGAGG + Intergenic
1040922975 8:52644547-52644569 AGTAAGAATTAACAATGAGGAGG - Intronic
1040963791 8:53064066-53064088 AGAAAGACATAAGAAGGAGGAGG + Intergenic
1044173464 8:89086553-89086575 AGTCACACCTAACACTGAAGAGG + Intergenic
1044290364 8:90461886-90461908 AGTCAAACCCAAGACTGAGATGG + Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1047684653 8:127292816-127292838 AGTCAGCCCAATGAAGGAGGAGG + Intergenic
1048235523 8:132686179-132686201 AGTGAGACCTGAGAAGGAGAAGG + Intronic
1050005195 9:1122174-1122196 AGTCACACCTCAAAATGAGGAGG - Intergenic
1054887931 9:70219407-70219429 AGCCAGAAGTAAGAATGAGTAGG - Intronic
1056728332 9:89142181-89142203 AGTCATTCCTAAGATTTAGGGGG - Intronic
1057558812 9:96111276-96111298 AGGCAGACAGAAGAATGTGGAGG + Intronic
1057874979 9:98746932-98746954 AGCCAGAGCTAAGCAGGAGGAGG + Intronic
1189999529 X:46672178-46672200 AGACAGACAAAAGAATGTGGGGG - Intronic
1198663046 X:138991579-138991601 AGTCAGATCTCTGAATCAGGTGG + Intronic