ID: 1073181283

View in Genome Browser
Species Human (GRCh38)
Location 10:101585021-101585043
Sequence AGTCAGACCTAAGAATGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073181274_1073181283 23 Left 1073181274 10:101584975-101584997 CCTTAAAGGTGGGGGTCATCTTC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1073181283 10:101585021-101585043 AGTCAGACCTAAGAATGAGGCGG 0: 1
1: 0
2: 0
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073181283 Original CRISPR AGTCAGACCTAAGAATGAGG CGG Intronic